ID: 1090323991

View in Genome Browser
Species Human (GRCh38)
Location 11:125869341-125869363
Sequence TCACCTTTTTAGTTGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090323991_1090324002 28 Left 1090323991 11:125869341-125869363 CCCTGAATCAACTAAAAAGGTGA No data
Right 1090324002 11:125869392-125869414 ATTTATCAAGGGCTCCTGGTGGG No data
1090323991_1090324001 27 Left 1090323991 11:125869341-125869363 CCCTGAATCAACTAAAAAGGTGA No data
Right 1090324001 11:125869391-125869413 AATTTATCAAGGGCTCCTGGTGG No data
1090323991_1090324000 24 Left 1090323991 11:125869341-125869363 CCCTGAATCAACTAAAAAGGTGA No data
Right 1090324000 11:125869388-125869410 CCAAATTTATCAAGGGCTCCTGG No data
1090323991_1090323994 16 Left 1090323991 11:125869341-125869363 CCCTGAATCAACTAAAAAGGTGA No data
Right 1090323994 11:125869380-125869402 TCCCACCTCCAAATTTATCAAGG No data
1090323991_1090323993 -7 Left 1090323991 11:125869341-125869363 CCCTGAATCAACTAAAAAGGTGA No data
Right 1090323993 11:125869357-125869379 AAGGTGACAAGCTCATGTTTAGG No data
1090323991_1090323996 17 Left 1090323991 11:125869341-125869363 CCCTGAATCAACTAAAAAGGTGA No data
Right 1090323996 11:125869381-125869403 CCCACCTCCAAATTTATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090323991 Original CRISPR TCACCTTTTTAGTTGATTCA GGG (reversed) Intergenic