ID: 1090324214

View in Genome Browser
Species Human (GRCh38)
Location 11:125870814-125870836
Sequence TAGTTGTTTTTAAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090324208_1090324214 19 Left 1090324208 11:125870772-125870794 CCTCTGACTTTTCATTTTGAGGT 0: 19
1: 3
2: 3
3: 28
4: 344
Right 1090324214 11:125870814-125870836 TAGTTGTTTTTAAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090324214 Original CRISPR TAGTTGTTTTTAAGGAAAAA AGG Intergenic
No off target data available for this crispr