ID: 1090325899

View in Genome Browser
Species Human (GRCh38)
Location 11:125886470-125886492
Sequence CCAAGCAAACCTATCTCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090325899_1090325902 4 Left 1090325899 11:125886470-125886492 CCAGTTGAGATAGGTTTGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1090325902 11:125886497-125886519 GACTAGGATATTGAACCCTGAGG 0: 1
1: 0
2: 2
3: 4
4: 60
1090325899_1090325903 5 Left 1090325899 11:125886470-125886492 CCAGTTGAGATAGGTTTGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG 0: 1
1: 0
2: 2
3: 9
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090325899 Original CRISPR CCAAGCAAACCTATCTCAAC TGG (reversed) Intronic
908311432 1:62888417-62888439 CCAAGCAAACCTATTATAAATGG + Intergenic
910969733 1:92844159-92844181 CCAAGGAAACCTCTCTGAACTGG - Exonic
916591521 1:166195327-166195349 CCAAGCAAACTATTCCCAACTGG - Intergenic
917910553 1:179640437-179640459 ACAAGCAAACATACCTCTACTGG - Exonic
918510613 1:185309878-185309900 CCAAGGAAACCTATATGTACTGG - Intronic
920658065 1:207891104-207891126 GGAAGCAGACCTATTTCAACTGG - Intronic
921232840 1:213090981-213091003 CCAAAATAACATATCTCAACAGG - Intronic
923479996 1:234374987-234375009 CCAACAACACCTATCTTAACAGG - Intronic
1069246997 10:66219130-66219152 CCAAGAAAACTTATCATAACTGG + Intronic
1069689183 10:70338361-70338383 CCGAGCAAGCCTATCTCATAGGG - Intronic
1072274387 10:93808411-93808433 CCCAGCAAACCCAAGTCAACAGG - Intergenic
1075577057 10:123585138-123585160 CCCAGCAAACCCATCTCCATGGG + Intergenic
1082998618 11:59272312-59272334 CCAAGCATACCTGTCACACCTGG - Intergenic
1083054214 11:59804169-59804191 CATAGCACACCTAACTCAACAGG + Intergenic
1083783800 11:64932454-64932476 CTAATAATACCTATCTCAACAGG - Intronic
1085760929 11:79240760-79240782 CCATTAAAACCTTTCTCAACGGG + Intronic
1089846238 11:121460783-121460805 CCAAGCTAGCCTTTCTCCACAGG - Intronic
1090325899 11:125886470-125886492 CCAAGCAAACCTATCTCAACTGG - Intronic
1095419705 12:42012417-42012439 CCAAGCAACTCTTTCTCACCTGG + Intergenic
1096142099 12:49250870-49250892 CCAAACATACCTATATCAAGTGG + Intronic
1096491700 12:52016143-52016165 CCAAGCACACGTATTTCTACAGG - Intergenic
1106511448 13:30416937-30416959 CCTAGCAAACACACCTCAACAGG + Intergenic
1106588967 13:31082026-31082048 CCAAACATACCTATCCCAAAGGG + Intergenic
1107599013 13:41993561-41993583 CCTTGCAAACCTTTCTCCACTGG + Intergenic
1108085428 13:46785300-46785322 CAAACCAAATCTCTCTCAACTGG - Intronic
1126350373 15:47739499-47739521 CCACTAAAACCTATCTTAACAGG - Intronic
1133974317 16:10589674-10589696 CCAAGAATACCTTTCTCAATAGG - Intergenic
1134673893 16:16075895-16075917 ACATGCAAACCTCTCTCCACTGG - Intronic
1134868796 16:17632800-17632822 CCAAGCATACATATTTCATCTGG + Intergenic
1136513473 16:30753604-30753626 CCCAGCCAACCAATCTCATCAGG - Intronic
1136535404 16:30896492-30896514 CCAAGGAATCCTGTCTCAAAAGG + Intergenic
1137927687 16:52556684-52556706 CCAATCTAACCTATCACTACTGG + Intergenic
1139645734 16:68328455-68328477 CTATGCAAACCTACCCCAACAGG - Intronic
1141053347 16:80793127-80793149 CCAAGCAACCCAATCTAAAACGG + Intronic
1146445527 17:32929711-32929733 CCAAGGAAGCCTTTCTCAAAGGG - Intronic
1146715935 17:35087384-35087406 CCAAGCAGAGTTATGTCAACTGG + Intronic
1148517877 17:48238667-48238689 CTATTTAAACCTATCTCAACTGG - Intronic
1148804078 17:50255455-50255477 CCAGGCAAACCTATCCCCAAAGG + Intergenic
1149041846 17:52199144-52199166 CCTAGCAAACTGATTTCAACAGG - Intergenic
1149360245 17:55887716-55887738 CCAAGCATACCCCTCTCAAGAGG - Intergenic
1150926761 17:69540414-69540436 CCAACCAAACCTACCCCAAATGG - Intronic
1152002353 17:77654646-77654668 CCCAGCAAACCTGTCTCAGGCGG + Intergenic
1156939107 18:42743322-42743344 CAAAACAAAACTATCTCAAGAGG + Exonic
1158742900 18:60164310-60164332 CCCAGCAGCCCTATTTCAACAGG + Intergenic
1159677075 18:71298237-71298259 CCAAGAAAACTGATCTCAATTGG + Intergenic
1164916580 19:32057151-32057173 CCAAGGAAGCCTGTCTCAAGGGG + Intergenic
1166257292 19:41615547-41615569 CCATGCAACCCTCTCTCACCAGG - Intronic
925829403 2:7879311-7879333 CAATGCAAGCCAATCTCAACAGG - Intergenic
928230138 2:29491262-29491284 CCACGGAAACCTGTCTCTACAGG - Intronic
929803306 2:45122787-45122809 CAAAGCAAACCTTATTCAACTGG + Intergenic
932253622 2:70265709-70265731 ACAAGCCAAGATATCTCAACAGG - Intronic
932958883 2:76388869-76388891 CAAAGCCAACCTCTCTCATCTGG - Intergenic
942623923 2:177878440-177878462 CCAAGCACACATATTTCATCAGG - Intronic
944297719 2:198085869-198085891 CCAAGTAAACCTACCTGAGCTGG + Exonic
949053000 2:241907508-241907530 GCAAGCAAAGCTATCTCCAGCGG + Intergenic
1170238361 20:14133583-14133605 CCTAACAAACCTATCTGAAATGG - Intronic
1173049758 20:39548002-39548024 TCAAGAAAACCAATCTGAACAGG + Intergenic
1173896188 20:46552467-46552489 CCATGCAGACCAATCTTAACAGG + Intergenic
1176988184 21:15462253-15462275 CCAAACAACCTTATTTCAACAGG - Intergenic
949459909 3:4280328-4280350 CCAAGCAAACCTAAGTTAAATGG - Intronic
954894384 3:53963527-53963549 CCCAGCCAACCTAGCTCAAGGGG - Intergenic
956782027 3:72611371-72611393 CCTAGCATACCTATCTCATCGGG - Intergenic
957231267 3:77518872-77518894 CAAAGCATACCTATCTCATTGGG + Intronic
963443399 3:145370634-145370656 CAAAACAAACATATTTCAACTGG + Intergenic
965564566 3:170100175-170100197 GGAAGGAAGCCTATCTCAACTGG + Intronic
965872613 3:173279512-173279534 CCAGACAATCCTATATCAACTGG + Intergenic
967140026 3:186549556-186549578 TCAAGCAATCCTGTCTCAGCTGG - Intronic
968428684 4:540271-540293 CCAAACACACATATCACAACAGG - Intergenic
969586904 4:8099191-8099213 CCAAGCAAATACATCCCAACTGG + Intronic
974019946 4:56684230-56684252 CAAAGCAAACTTATCTCACTGGG - Intergenic
976043764 4:80919887-80919909 CCAAGCAAACCCATATATACTGG - Intronic
980655586 4:135779737-135779759 ACACACAAACCTATCTCAAAGGG + Intergenic
982402626 4:154985010-154985032 CCAGGCAAGCCTTTCTAAACAGG - Intergenic
984711490 4:182889154-182889176 CAAAGCAAACCTCTATTAACTGG + Intergenic
984719801 4:182959052-182959074 CCAAGTAAAGCTATCTCTTCTGG - Intergenic
988952385 5:36276695-36276717 ACAAATAAACCTATTTCAACTGG + Intronic
997031478 5:130134062-130134084 CAAGGCAAACATATCTCACCAGG - Intronic
999966521 5:156816160-156816182 CCAAGGAACCCTGTCACAACTGG + Intergenic
1000253353 5:159515652-159515674 GCAAGTAAATCTTTCTCAACAGG + Intergenic
1002852056 6:1005144-1005166 CGAAGCACACATCTCTCAACAGG - Intergenic
1006511680 6:34524972-34524994 CCAGGGATACCTATCTCACCTGG + Intronic
1008495287 6:52126704-52126726 CCAAGCAAACATTTTTCAGCTGG + Intergenic
1008777189 6:55054509-55054531 CCAAGAAAACATATCTCAGGAGG - Intergenic
1010549896 6:77208741-77208763 TCAAGCTAACCAATCTCAAGGGG + Intergenic
1012866315 6:104622569-104622591 CCCAGCAAACCCTTCTCACCTGG - Intergenic
1013828678 6:114246483-114246505 CAAAGCAGACCTATTACAACTGG + Intronic
1018431819 6:163728870-163728892 ACAATCAAAACTATCTCGACAGG - Intergenic
1021273058 7:18616068-18616090 CCAACCAAGCCTTTCTCAAATGG + Intronic
1021976680 7:26018050-26018072 CCAAACAAACCTATGTGTACTGG - Intergenic
1025966534 7:66278140-66278162 CCAAGCAAACATCTCTCACCTGG - Intronic
1026098048 7:67362456-67362478 CAAAGCAAACCATTCTCAAGAGG - Intergenic
1027521469 7:79214291-79214313 CCAAGTAAACCTATTTAAAATGG - Intronic
1027899666 7:84094769-84094791 CAAAGCAAAAATATTTCAACGGG - Intronic
1036641513 8:10587067-10587089 TCAAGCACACCTATCTCTCCAGG - Intergenic
1039633404 8:39137224-39137246 CCAAGCCAGCCTTTCCCAACTGG - Intronic
1041309650 8:56502448-56502470 TCAAAAAACCCTATCTCAACTGG - Intergenic
1042685490 8:71434480-71434502 CCAAGCAAACCAATGTCAATAGG - Intronic
1044469222 8:92546808-92546830 TCAAGCAAACTAATCTCAAATGG - Intergenic
1045290651 8:100829952-100829974 CCATGGAAATCTATCTCTACTGG - Intergenic
1045796541 8:106052211-106052233 CCAAGAAAACCTCTCTCAGTAGG + Intergenic
1047515900 8:125554645-125554667 CCAATAAAACCTATCTCAGAGGG + Intergenic
1047982136 8:130194326-130194348 GAAAGCAAACCAATCTCAAGAGG + Intronic
1049505141 8:142992201-142992223 CCAAGCAAACCATCCTCATCAGG + Intergenic
1051770503 9:20573096-20573118 CAAAGTAAAACTATCACAACAGG + Intronic
1057604952 9:96492441-96492463 CCAAGCACCCCTATCTCTAGAGG - Intronic
1185934324 X:4238604-4238626 CCAAGGATTCCTATCTCACCAGG + Intergenic
1197536856 X:127700641-127700663 CCAACCAAACCTAACTCATATGG - Intergenic