ID: 1090325903

View in Genome Browser
Species Human (GRCh38)
Location 11:125886498-125886520
Sequence ACTAGGATATTGAACCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090325899_1090325903 5 Left 1090325899 11:125886470-125886492 CCAGTTGAGATAGGTTTGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG 0: 1
1: 0
2: 2
3: 9
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090325903 Original CRISPR ACTAGGATATTGAACCCTGA GGG Intronic
902099073 1:13970477-13970499 AGTTGGAGTTTGAACCCTGAGGG + Intergenic
902741163 1:18439403-18439425 GCCAGGATATTGAAGCCTGAGGG + Intergenic
908238640 1:62170659-62170681 AGGAGGATCTTGAACCCGGAAGG + Intergenic
911304612 1:96217662-96217684 CCTAGAAGATAGAACCCTGATGG + Intergenic
912589298 1:110798734-110798756 ACAAGAATATTGGTCCCTGAGGG + Intergenic
914735007 1:150407845-150407867 CATAGGATATTGAAGCCAGAGGG + Intronic
920287276 1:204889675-204889697 ACAAGGATATTGCACACTGGGGG - Intronic
922142399 1:222901870-222901892 AAAAGGAAATTGAACCCAGATGG + Intronic
1065227508 10:23559488-23559510 ACTAGGCTATAAAACCCTTATGG + Intergenic
1065644087 10:27816417-27816439 CCTAGGATATTGAACGATGCTGG - Intronic
1066593788 10:37025813-37025835 AGTTGGATTTTGAACCCAGATGG + Intergenic
1069548233 10:69344001-69344023 ACCCAGAGATTGAACCCTGAGGG + Intronic
1082632875 11:55561529-55561551 AGGAGGATATTGATGCCTGAAGG - Intergenic
1085437459 11:76521254-76521276 AATAGGATTTTGAAACATGAGGG + Intronic
1085894520 11:80622508-80622530 AGTTGGATTTTGAACCCAGATGG - Intergenic
1087319954 11:96645949-96645971 AAAAGGAGATTTAACCCTGAAGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1103688885 12:122754043-122754065 ACTAGGTTATTTCAGCCTGAAGG + Intronic
1110331609 13:74279191-74279213 ACTGGGATATTAAACCATAATGG + Intergenic
1116113455 14:40617094-40617116 AATATCATATTGAATCCTGAAGG + Intergenic
1118208044 14:63741569-63741591 GCAAAGATATTGAAGCCTGAAGG + Intergenic
1120638477 14:86980736-86980758 AACAGGATAATGAACCCTCATGG - Intergenic
1123189965 14:106559682-106559704 ACACGGATATTCATCCCTGATGG - Intergenic
1125271563 15:37944435-37944457 ACTAGGTCATTGAACCATCATGG - Intronic
1131162907 15:90120009-90120031 ATTAGGAAATTGAACCCAGGAGG - Intergenic
1133454897 16:5933478-5933500 ACAAGGAGATTCAACCCTGACGG - Intergenic
1135476152 16:22777423-22777445 AAAAGGATATTGAACACAGAAGG + Intergenic
1143053620 17:4146183-4146205 ACAAGAATATTGAACCCGGGAGG - Intronic
1144040618 17:11407440-11407462 AATAAGATAGAGAACCCTGATGG - Intronic
1145030527 17:19501571-19501593 ACTTGAAAACTGAACCCTGAAGG - Intronic
1148720270 17:49747530-49747552 ACTAGGATCTTTGATCCTGAAGG - Intronic
1156692878 18:39729494-39729516 ATTAGGAAAATGAACCCTGAAGG - Intergenic
1161195415 19:2983671-2983693 ACTTGGGCTTTGAACCCTGAGGG + Intronic
934993066 2:98935123-98935145 ACTAGGTTATTGGAGCCTGCAGG - Intronic
1169746194 20:8945543-8945565 ACTAGGAAATTCAACCCTGAAGG + Intronic
1173789646 20:45819660-45819682 AGAAGGAAATTGAGCCCTGAGGG + Intergenic
1177268815 21:18819672-18819694 CCTGGGAAATTGTACCCTGATGG - Intergenic
1177281737 21:18989908-18989930 AGTAGTATATTGAAACCAGAGGG - Intergenic
1180988968 22:19922516-19922538 TCTGGGATCTTGAACACTGAAGG - Intronic
958537081 3:95418104-95418126 ACTACTATCTTAAACCCTGAAGG - Intergenic
959224910 3:103568118-103568140 ACAAGGCTAGTGAGCCCTGAGGG + Intergenic
960460228 3:117925191-117925213 ACTAGGATAATGAACCATGAGGG - Intergenic
961226325 3:125251518-125251540 ATTAGGATAGTGATCACTGATGG - Intronic
962811746 3:138964497-138964519 AGAAGGAAATTGAACTCTGAAGG - Intergenic
963715702 3:148801236-148801258 AGTTGAATATTGACCCCTGAGGG - Intronic
971141576 4:23930668-23930690 AAAAGTACATTGAACCCTGAAGG - Intergenic
971188786 4:24406931-24406953 AAGAGGATACTGATCCCTGAGGG - Intergenic
975223234 4:71838561-71838583 ACTAAGACATTGAACCCTGTGGG + Intergenic
975836440 4:78427102-78427124 ACAAGGTAATTGAAACCTGAAGG + Intronic
982216189 4:153084582-153084604 ACTCTGAGATTAAACCCTGAGGG - Intergenic
982964890 4:161893857-161893879 ACCAGGATATTGAATCTTTAGGG - Intronic
983425228 4:167575194-167575216 CCTAGGATATTGCCCCCTAAAGG + Intergenic
984088587 4:175342470-175342492 ATGAAGATATTAAACCCTGAAGG + Intergenic
987283376 5:16433589-16433611 AATAGGATAATGAACCTTCATGG - Intergenic
990856415 5:60272252-60272274 ACTAGAATTTTGGACCCTCAAGG - Intronic
991426947 5:66501933-66501955 ACAAGGAAATTGAACCCAGAAGG - Intergenic
996647070 5:125829069-125829091 ACTTGGATATTGTGTCCTGAAGG - Intergenic
1004780219 6:18900158-18900180 ACATGGCTATTGAACCCTCAAGG - Intergenic
1005325552 6:24696667-24696689 ACCATGATATTATACCCTGATGG + Intronic
1023303960 7:38803761-38803783 AATGGGGTCTTGAACCCTGAAGG + Intronic
1029061053 7:97798234-97798256 ACTTGGACATTGAACCCTGGCGG - Intergenic
1034312801 7:150104260-150104282 ACTATGAGATTGAACCTTGAAGG + Intergenic
1034794057 7:153996405-153996427 ACTATGAGATTGAACCTTGAAGG - Intronic
1037216420 8:16457654-16457676 ATAAGGATATTTAACCCTAAAGG + Intronic
1040936444 8:52786891-52786913 AGGAGGATCTTGAACCCAGAAGG - Intergenic
1041271497 8:56113579-56113601 CCTAGGCTATTGGACCCTGCGGG + Exonic
1043668944 8:82856561-82856583 TCTATGATAGTGAACCATGATGG - Intergenic
1044942731 8:97359999-97360021 ACTAGTATATTAATTCCTGATGG - Intergenic
1045415239 8:101959890-101959912 CCTAAGGTATTGAAGCCTGAGGG - Intronic
1047810842 8:128407171-128407193 ATTATGATAATAAACCCTGAGGG - Intergenic
1055295364 9:74827684-74827706 ACTAGGAGAGTGAGCTCTGATGG + Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1187599914 X:20817280-20817302 ATCAGGAAATTTAACCCTGATGG - Intergenic
1188426364 X:30051946-30051968 GCAATGAAATTGAACCCTGAAGG - Intergenic
1189153981 X:38736643-38736665 ACAAGGGTACTGAACCCAGAAGG + Intergenic