ID: 1090326162

View in Genome Browser
Species Human (GRCh38)
Location 11:125887930-125887952
Sequence CGTTCCTGAGGGAGGCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090326148_1090326162 21 Left 1090326148 11:125887886-125887908 CCGTGGATTCCAGGTCCTGCCTG 0: 1
1: 1
2: 4
3: 41
4: 426
Right 1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1090326150_1090326162 12 Left 1090326150 11:125887895-125887917 CCAGGTCCTGCCTGGCGAGCCGT 0: 1
1: 0
2: 1
3: 3
4: 103
Right 1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1090326152_1090326162 2 Left 1090326152 11:125887905-125887927 CCTGGCGAGCCGTCCCCAACGTC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1090326151_1090326162 6 Left 1090326151 11:125887901-125887923 CCTGCCTGGCGAGCCGTCCCCAA 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1090326153_1090326162 -7 Left 1090326153 11:125887914-125887936 CCGTCCCCAACGTCTGCGTTCCT 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1090326147_1090326162 24 Left 1090326147 11:125887883-125887905 CCTCCGTGGATTCCAGGTCCTGC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156
1090326146_1090326162 25 Left 1090326146 11:125887882-125887904 CCCTCCGTGGATTCCAGGTCCTG 0: 1
1: 0
2: 2
3: 7
4: 174
Right 1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG 0: 1
1: 0
2: 2
3: 17
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090326162 Original CRISPR CGTTCCTGAGGGAGGCGGCC GGG Intronic
900296438 1:1953943-1953965 CATTCCTCAGGGAGGAGGGCTGG + Intronic
900349073 1:2226655-2226677 CTATCCTGGGGGAGCCGGCCCGG - Intergenic
904322279 1:29705711-29705733 CATTGGTGAGGGAGGAGGCCAGG - Intergenic
907213555 1:52843145-52843167 CGTTGTCGGGGGAGGCGGCCTGG + Intronic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
912752089 1:112294246-112294268 CGTCCGGGAGGGAGGCGGCGGGG + Intergenic
913994211 1:143638865-143638887 CGTCCGGGAGGGAGGCGGCGGGG + Intergenic
915272889 1:154767665-154767687 CCTCCCTGAGGGAGGTGGGCAGG + Intronic
915537975 1:156548964-156548986 CACTCCTGAGGGAGGCAGCGTGG + Intronic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
922062207 1:222103698-222103720 CTGTGCTGAGGGAGGGGGCCCGG + Intergenic
923065878 1:230517038-230517060 CAATCCTGAGGCAGGCAGCCCGG + Intergenic
924624897 1:245689359-245689381 CATCCCTGAGAGAGGCTGCCAGG - Intronic
1062915788 10:1240567-1240589 GGGTCCTGGGGGAGGCAGCCGGG - Intronic
1063339798 10:5252495-5252517 AGGGCCTGAGGGAGGCAGCCAGG - Intergenic
1063343933 10:5294156-5294178 AGGGCCTGAGGGAGGCAGCCAGG + Intergenic
1066180781 10:32958505-32958527 CGCGCCTGAGGGAGGCCGCGGGG + Intronic
1067167451 10:43877111-43877133 GGTTGCTGAGGGAGGTGGGCCGG - Intergenic
1067728915 10:48794822-48794844 CCTTTCTGAGGGAGGTAGCCAGG + Intronic
1069906482 10:71735372-71735394 CGTTCCTAGAAGAGGCGGCCCGG + Intronic
1077102900 11:830078-830100 CCTGCCTGGAGGAGGCGGCCCGG + Exonic
1077311390 11:1890444-1890466 AGCTCCTGAGGAAGGCAGCCCGG - Exonic
1077352999 11:2101385-2101407 GGTTCCTGAGGGAGGGGCACAGG - Intergenic
1077421364 11:2451649-2451671 AGTTCCTGCCAGAGGCGGCCAGG - Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1078180537 11:9006349-9006371 CTTTCCTCAGGGAGGAAGCCAGG + Intergenic
1081757813 11:45557084-45557106 CGTTCCTGAGGGCTGAGGTCTGG + Intergenic
1083879857 11:65543063-65543085 GGTTCCTGAGGGATGTGGCAGGG - Intronic
1083928145 11:65821607-65821629 AGTTCCTGAGCCAGGCAGCCAGG + Intergenic
1084489436 11:69470592-69470614 GGCTCCTGAGTGAGGCTGCCGGG + Intergenic
1084760919 11:71270334-71270356 TGTTCCTGCGGGAGCCGGACTGG - Intergenic
1086657884 11:89382133-89382155 CTTTCCTGAGGGGGGAGGGCAGG + Intronic
1088657956 11:112019078-112019100 CTTTCCTGAGTGAAGCAGCCAGG - Intronic
1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG + Intronic
1091346106 11:134855277-134855299 CTTTCCTGAGGATGGGGGCCGGG - Intergenic
1091847211 12:3666577-3666599 AGTTCCTGTGGGAGGCTGGCAGG - Intronic
1091961921 12:4702971-4702993 CTTTGATGAGGGAGGGGGCCAGG + Intronic
1091985883 12:4910055-4910077 CGATCCCGAAGGAGGCGGGCGGG - Exonic
1093632669 12:21428373-21428395 CGTTCCTGAGGCAGACGGCTGGG + Intergenic
1096498341 12:52051301-52051323 GGTTCCGGCGGGAGGCGGCCAGG - Intronic
1105411820 13:20177387-20177409 CGCCCCTGCGGGAGGCGGCGCGG - Intergenic
1106183626 13:27388959-27388981 AGTTTCTGAGGGAGGGGGGCAGG - Intergenic
1106891069 13:34246104-34246126 CTTTCTTGAGGGAGGCTTCCTGG - Intergenic
1108555164 13:51584527-51584549 CGTTCCCGAGAGAGGCGGCCAGG + Exonic
1113493945 13:110713619-110713641 CGTTGCCGGGGGAGGGGGCCGGG + Intronic
1113531749 13:111032402-111032424 AGTTCCTGCAGGAGGTGGCCTGG - Intergenic
1113561565 13:111285798-111285820 CGCTCCTGAGGGAGGAGGAGAGG - Intronic
1119472747 14:74909750-74909772 GGTTCCTGAGGGGGCCGGCCCGG - Exonic
1121438696 14:93935300-93935322 GGCTCCTGGGGGAGGCAGCCAGG - Intronic
1122113603 14:99517215-99517237 CATTCCTGTGGGAGCCAGCCAGG - Intronic
1122715714 14:103695849-103695871 TGTTTCAGAGGGAGGCGGCAAGG + Intergenic
1122781682 14:104146424-104146446 GGGTCCTGAGGGCGGAGGCCAGG + Intronic
1123450481 15:20356785-20356807 GGGTCCTGAGGGAGCCAGCCGGG - Intergenic
1129108105 15:73322845-73322867 AGGTCCTGGGTGAGGCGGCCGGG + Exonic
1129269215 15:74410665-74410687 CCAGCCAGAGGGAGGCGGCCAGG + Exonic
1129351108 15:74956514-74956536 CGGGGCCGAGGGAGGCGGCCCGG - Exonic
1131107318 15:89743966-89743988 CGTTCCTGAGCCAGCAGGCCAGG - Intergenic
1138898148 16:61234843-61234865 CTTTTCTGAGGAAGTCGGCCTGG + Intergenic
1142150347 16:88509922-88509944 CGTTGTTGAGGGAGGCGACAGGG + Intronic
1142260272 16:89039572-89039594 CCTTGCTGAAGGAGGCGGCCAGG - Intergenic
1142274121 16:89107005-89107027 CGATCCTGAGGAAGTCGGCCAGG - Intronic
1142480339 17:215009-215031 CGTTCCTGTGGGTGGCTGCCGGG + Intronic
1142664773 17:1456277-1456299 CCTGCCCGAGGGAGGCTGCCGGG + Intronic
1142985816 17:3694974-3694996 CGCTCAGGTGGGAGGCGGCCAGG + Intronic
1143266189 17:5639725-5639747 AGTTCCTGAGGAAGGGGCCCTGG + Intergenic
1143670466 17:8392774-8392796 CGCACCTCAGGGAGGCCGCCGGG - Exonic
1146649312 17:34597038-34597060 CCTGCCTGAGGGAGGAGGCAGGG - Intronic
1148466602 17:47868789-47868811 GGTTCCTGAGGTAGGGGGCTTGG + Intergenic
1149654912 17:58305096-58305118 TGGGCCTGAGGCAGGCGGCCTGG - Exonic
1150212784 17:63450579-63450601 AGTTCCTCAGGGAGCAGGCCCGG - Intergenic
1150621917 17:66814158-66814180 CCTTCCTGGGGGAGGAGGCAGGG + Intergenic
1150714262 17:67557953-67557975 CTTTCCTCAGAGAGGCAGCCCGG + Intronic
1152297773 17:79478294-79478316 CGTCCCTGAGGGTGGGGGCCGGG + Intronic
1156688203 18:39675296-39675318 CATTTCTGAGGGAGGGAGCCCGG - Intergenic
1157529872 18:48410781-48410803 CGCTTCTGAGGGAGGAGCCCCGG - Intergenic
1159060721 18:63511324-63511346 CTTTCCTTAGGGAGGATGCCTGG + Intergenic
1160691521 19:462411-462433 CCTCCCTGAGGGATGCAGCCTGG - Intergenic
1160708033 19:538958-538980 GGTGCCTCAGGGAGGTGGCCGGG - Intronic
1160865145 19:1253003-1253025 CCTTCCTGACGCAGGCGCCCAGG - Intronic
1161043457 19:2122094-2122116 CCTTCCTGAGGGAGCCGGCATGG - Intronic
1161107511 19:2451957-2451979 CGTTCCCGAGGGAGGAGACCTGG - Intronic
1161339947 19:3735981-3736003 CGCTGATGAGGGAGGCAGCCTGG - Intronic
1162553853 19:11374464-11374486 CTTCCCTGAGGGAGGCTGCTGGG - Intergenic
1164611350 19:29634588-29634610 AGTGCCTGAGGGAGGCCTCCTGG + Intergenic
1165635470 19:37336199-37336221 CATTCCAGTGGGAGGCGGCAAGG + Intronic
1165862916 19:38918526-38918548 CCTTCCTGGGGGAGGAGGCCAGG + Exonic
1166852085 19:45765917-45765939 CGTGCCTGAGGGAGGCCTCCCGG - Exonic
1168275387 19:55275062-55275084 CGTCCCTGTGGGAGCCGGCCTGG - Intronic
925611642 2:5706591-5706613 CTTTCCTGGGGGTGGCGGCTGGG + Intergenic
925970169 2:9100958-9100980 CGTCCCTGAGGCACGCAGCCTGG + Intergenic
927652390 2:24920322-24920344 CGTTCCGGAGTGGGGCGGCGAGG + Intergenic
928129698 2:28640829-28640851 CGTTCCCGAGGGAGGGGCTCTGG + Intronic
929191802 2:39147071-39147093 TCTTCCTGAGGGAGGAGACCGGG + Intergenic
934717881 2:96553727-96553749 TGCTCCTGAAGGAGGTGGCCAGG - Intergenic
935251975 2:101271049-101271071 CGTTCCTGACGGAGGCTGGACGG - Intergenic
935341231 2:102061499-102061521 CTGTCCAGAGGGAGGGGGCCGGG + Intergenic
940839174 2:158559388-158559410 CATGCCTGAGGGAGGCAGGCAGG + Intronic
944242369 2:197499335-197499357 CGATGCTGGGGGCGGCGGCCCGG + Intronic
946751045 2:222896205-222896227 CGTCCGGGAGGGAGGCGGCGGGG - Intronic
948771356 2:240252778-240252800 CCTGACAGAGGGAGGCGGCCTGG + Intergenic
948920810 2:241065059-241065081 TGTTCCTCAGGGAAGGGGCCTGG - Intronic
1168757294 20:326187-326209 CGTTCGTGCGGGAGGCGGAGCGG + Exonic
1169637553 20:7709314-7709336 TGTTCCTGAGGAAGGGGGACAGG - Intergenic
1171201430 20:23245135-23245157 CTTTCCTGAGGGAGGTGGCCAGG - Intergenic
1174179453 20:48665835-48665857 CTTATCTGAGGGAGGAGGCCGGG + Intronic
1174343009 20:49909672-49909694 CTTTCCTGAGGCAGGAAGCCTGG + Intronic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1179888632 21:44325135-44325157 CGTTCCTGAGAGGGGCAGCAGGG - Exonic
1179988116 21:44932374-44932396 CGCGCCCCAGGGAGGCGGCCAGG - Intergenic
1180170181 21:46054571-46054593 CGGTCCTGACGGAGCAGGCCAGG + Intergenic
1182015081 22:27032572-27032594 CGTGCCTGTGGGAGGCGGGCCGG + Intergenic
1182421184 22:30249277-30249299 CTTCCATGAGGGAGCCGGCCGGG - Intergenic
1183976743 22:41516621-41516643 GGCTCCTGAGGCAGGTGGCCTGG + Intronic
1184184663 22:42856865-42856887 CGTTCCCGGGGGCGGCGGCGCGG - Intronic
1184202696 22:42981465-42981487 CGTCCGGGAGGGAGGCGGCGGGG + Intronic
1185068116 22:48642077-48642099 CTTTTCTGAGGGGGGCAGCCTGG + Intronic
1185146540 22:49140084-49140106 ACTTCCTGGGGGAGGCAGCCGGG - Intergenic
954644549 3:52122945-52122967 AGTTCCTGCGGGCGGTGGCCTGG + Intronic
956135211 3:66091738-66091760 TGTTCCTGATAGAGGCTGCCTGG + Intergenic
960026802 3:113019488-113019510 CGTTTCCGGGGGAGGCCGCCAGG - Intronic
960096358 3:113694069-113694091 AGTTTCTGAGGGAAGTGGCCTGG + Intronic
968444817 4:646668-646690 CGTGTCTGAGGAAGGGGGCCGGG - Intronic
968734441 4:2288145-2288167 GCTTCCTGGAGGAGGCGGCCTGG + Intronic
968896877 4:3409556-3409578 CATTGCTGAGGGAGGCGGCAAGG + Intronic
969056278 4:4404858-4404880 CCTTCCTGGGGCAGGGGGCCTGG + Intronic
969443840 4:7233101-7233123 CCTTCCTGATGGAGGAGGCTGGG + Intronic
970601207 4:17642224-17642246 CGCTCCTGAGGAAGGCAACCAGG + Exonic
977697093 4:99977821-99977843 CGTTCCTGAGGGTGGAGGGTGGG + Intergenic
980977334 4:139623829-139623851 CGTTTCTGAAGCAGGAGGCCTGG - Intergenic
985035896 4:185839547-185839569 CGCTCCCTAGGGAGGAGGCCTGG + Intronic
985682836 5:1265437-1265459 AGTTCCTGAGGGTGCTGGCCAGG - Intronic
986331517 5:6719700-6719722 TGTGCCTGAGTGAGGTGGCCAGG + Intronic
986875353 5:12100775-12100797 AGTTCTTGAGGCAGGCTGCCTGG + Intergenic
990295045 5:54392987-54393009 CCTTCTTGAGGGAGGAGGCTGGG - Intergenic
991507464 5:67340312-67340334 AGTCCCTGAGGGAGCAGGCCTGG + Intergenic
991975392 5:72179544-72179566 CTTTCCTGCGGCAGGCGGGCGGG - Intronic
995060680 5:107808897-107808919 CGGTCCTTAGGGAGGCCCCCTGG - Intergenic
997796221 5:136814061-136814083 AGTTTCTGATGGAGGAGGCCTGG - Intergenic
1001436736 5:171705093-171705115 AGTTCCTGGGGGAGGGGGCTGGG + Intergenic
1002616167 5:180457809-180457831 CGGGCCTGAGGGAGGAGGCCTGG + Intergenic
1002639851 5:180625595-180625617 CGCTCTTGAGGGAGGTGGGCAGG + Intronic
1003306438 6:4933341-4933363 AGTTGCTGAGGGAGGAGGCGAGG - Intronic
1004712763 6:18188039-18188061 CGTTCCTCAGGGAGGGGAGCGGG - Intronic
1007618095 6:43194139-43194161 GGTTCCTGAGGGAGACAGGCAGG + Intronic
1008434341 6:51457452-51457474 CTTTCCAGAGGGAGGCTGGCTGG + Intergenic
1018856246 6:167677379-167677401 CATCCCTGAGGGAGGGGGCTGGG + Intergenic
1019193116 6:170265556-170265578 AGGTCCTGCGGGAGGCGTCCAGG - Intergenic
1019348992 7:544411-544433 CCTGCCTGGGGGAGGCCGCCCGG - Intergenic
1029259795 7:99294075-99294097 TTTTCTCGAGGGAGGCGGCCCGG - Intergenic
1029459517 7:100686977-100686999 GGCTGCTGAGGGCGGCGGCCGGG - Intronic
1029525169 7:101089517-101089539 CGTTACTGAGGGACACGACCAGG - Exonic
1029577605 7:101413740-101413762 CCATCCTGATGGAGGCTGCCGGG + Intronic
1029610320 7:101623116-101623138 GGTCCCTGGGGGAGGTGGCCGGG - Intronic
1031371683 7:120975513-120975535 AGTTCATGAGGGAGGGGGCGGGG + Exonic
1031590439 7:123584378-123584400 AGTATCTGAGGGAGGCGGCTAGG + Intronic
1035832730 8:2715022-2715044 CCTTCCTAATGGAGGGGGCCCGG + Intergenic
1036009154 8:4701497-4701519 AGTCCCTCTGGGAGGCGGCCTGG - Intronic
1036586969 8:10133357-10133379 CCTTCCTGACGGAGGAGTCCAGG - Intronic
1039467466 8:37795045-37795067 CTTTCCTGAGGAATGCAGCCTGG + Intronic
1040014795 8:42691508-42691530 CGTTCCTCAGGGCTGCAGCCTGG - Intergenic
1044716279 8:95102651-95102673 GGTACCTGAGGGAGGTGCCCTGG + Intronic
1046683559 8:117198860-117198882 GGTTCTTGAGGCAGGCTGCCTGG + Intergenic
1049356545 8:142191996-142192018 GGTTCCTGAATGAGGCGGCCTGG + Intergenic
1049358172 8:142198959-142198981 TGTTAGTGAGGGAGGCGTCCAGG - Intergenic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049817831 8:144616182-144616204 AGTTCCTGAGAGAGGCAGTCTGG + Intergenic
1054814123 9:69458296-69458318 CGTTTCTGTGGGAGGAGGACTGG + Intronic
1060484968 9:124041065-124041087 CGGTCCCGGGGGAGCCGGCCCGG + Intergenic
1061625982 9:131840939-131840961 CTCTCCTGAGGGAGGAAGCCAGG + Intergenic
1062354057 9:136153583-136153605 CCTTCCAGAAGGGGGCGGCCAGG - Intergenic
1062628784 9:137454439-137454461 AGTTCCTGGGGGAGGAAGCCAGG + Exonic
1062710365 9:137972021-137972043 GGTTCCTGAGGGGGGAGTCCTGG + Intronic
1189596614 X:42573250-42573272 AGTTCCAGAGGGAGGCCACCAGG + Intergenic
1190567333 X:51743872-51743894 CGTTGCTGCCGGAGCCGGCCGGG - Exonic
1192169289 X:68844411-68844433 GGTTCCTCAGGGAGGCCACCTGG - Intergenic
1198201796 X:134428288-134428310 TGTTCCTGGGGGAGGGGGGCAGG + Exonic