ID: 1090327912

View in Genome Browser
Species Human (GRCh38)
Location 11:125904666-125904688
Sequence GCCCCACTTCGAACGCTCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 16}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090327912_1090327917 -6 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327917 11:125904683-125904705 TGGGGCGTCAGATGCTGGAGGGG 0: 1
1: 0
2: 2
3: 8
4: 199
1090327912_1090327916 -7 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327916 11:125904682-125904704 GTGGGGCGTCAGATGCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 177
1090327912_1090327923 19 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327923 11:125904708-125904730 ATGCGGGAAGGGTTTGGAAGAGG 0: 1
1: 0
2: 1
3: 15
4: 220
1090327912_1090327918 2 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327918 11:125904691-125904713 CAGATGCTGGAGGGGAGATGCGG 0: 1
1: 1
2: 5
3: 89
4: 696
1090327912_1090327919 3 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327919 11:125904692-125904714 AGATGCTGGAGGGGAGATGCGGG 0: 1
1: 0
2: 5
3: 49
4: 518
1090327912_1090327924 20 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327924 11:125904709-125904731 TGCGGGAAGGGTTTGGAAGAGGG 0: 1
1: 0
2: 3
3: 15
4: 244
1090327912_1090327926 30 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327926 11:125904719-125904741 GTTTGGAAGAGGGCCACAGAGGG 0: 1
1: 0
2: 0
3: 22
4: 247
1090327912_1090327921 8 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327921 11:125904697-125904719 CTGGAGGGGAGATGCGGGAAGGG 0: 1
1: 0
2: 1
3: 50
4: 575
1090327912_1090327925 29 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327925 11:125904718-125904740 GGTTTGGAAGAGGGCCACAGAGG 0: 1
1: 0
2: 0
3: 20
4: 272
1090327912_1090327915 -8 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327915 11:125904681-125904703 AGTGGGGCGTCAGATGCTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 153
1090327912_1090327920 7 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327920 11:125904696-125904718 GCTGGAGGGGAGATGCGGGAAGG 0: 1
1: 1
2: 18
3: 84
4: 680
1090327912_1090327922 13 Left 1090327912 11:125904666-125904688 CCCGCGAGCGTTCGAAGTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1090327922 11:125904702-125904724 GGGGAGATGCGGGAAGGGTTTGG 0: 1
1: 0
2: 0
3: 43
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090327912 Original CRISPR GCCCCACTTCGAACGCTCGC GGG (reversed) Intronic
901010649 1:6199805-6199827 GTCCCACTGCGAACGATCGGAGG + Intronic
910508664 1:87979058-87979080 GCCACACTTCGAATGCTCACTGG + Intergenic
1080283491 11:30584816-30584838 CACCCCCTTCCAACGCTCGCTGG - Intronic
1081778927 11:45696478-45696500 GCCCCATTTCACACGCTGGCAGG - Intergenic
1085830513 11:79895743-79895765 GCCCCACTTCCACGGCTCCCAGG + Intergenic
1088351368 11:108892119-108892141 GCCTCACTTCCAACACTCGGGGG - Intronic
1090327912 11:125904666-125904688 GCCCCACTTCGAACGCTCGCGGG - Intronic
1090395775 11:126416947-126416969 GCGCCCCTCCGAACTCTCGCTGG + Intronic
1097906235 12:64922256-64922278 GACCCATTTTGAACACTCGCAGG + Intergenic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1160944021 19:1632896-1632918 GCCCCACTTCCCACACTGGCAGG - Intronic
930245626 2:48980422-48980444 GCCCCACTGTGAACGCAGGCAGG - Intronic
948074748 2:235156978-235157000 GCCCCACTCCCATCGCTGGCTGG - Intergenic
1172417992 20:34787655-34787677 GCCCCACTTTGGAGGCTTGCCGG - Intronic
955066138 3:55535155-55535177 GCCCCACTTGGAAAGCTGGTTGG - Intronic
982550875 4:156797759-156797781 GCCGTACTTCAACCGCTCGCAGG - Intronic
985171043 4:187150480-187150502 GCCCCACTTCCAACGCTGGGGGG + Intergenic
1010740308 6:79495165-79495187 GCACAACTTAGAACCCTCGCAGG - Intronic
1022018617 7:26376816-26376838 GCCCCACCGCGTCCGCTCGCGGG - Intergenic