ID: 1090329185

View in Genome Browser
Species Human (GRCh38)
Location 11:125916952-125916974
Sequence AAGTGCTTGAAGAAGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090329181_1090329185 24 Left 1090329181 11:125916905-125916927 CCTCACGTGGAACAGGGGTGCGT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG 0: 1
1: 0
2: 4
3: 40
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090329185 Original CRISPR AAGTGCTTGAAGAAGAGTGA TGG Intronic
900794737 1:4701094-4701116 AGGTGCTTGGAGGAGACTGAAGG - Intronic
901145895 1:7064507-7064529 AAGTGCTGGGAGGAGGGTGATGG + Intronic
902959742 1:19954712-19954734 AAGTTCTGGAAGGAGATTGAAGG - Intergenic
905163209 1:36055483-36055505 TAGTGATTGAAGCTGAGTGATGG + Intronic
906511642 1:46413444-46413466 TAGGGCATGAAGAAGAGTGTGGG + Exonic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907371878 1:54009067-54009089 CAGTACTTGAAGAAGGTTGAAGG + Exonic
907432010 1:54417984-54418006 AGGTCCCTGAAGAAGTGTGATGG - Intergenic
908339653 1:63163549-63163571 AAGTCCTAGAAGATGAGGGAAGG - Intergenic
908354119 1:63315200-63315222 AAGGGATGGAAGAAGAGAGAAGG - Intergenic
908396405 1:63729184-63729206 AACTGCTTGAAGAGCAGTGCTGG - Intergenic
909030068 1:70529020-70529042 AAGTTCCTGAAGAAGGGTCATGG - Intergenic
911199402 1:95029328-95029350 AAGTGCTCCAAGAAGAGGCAAGG + Intronic
911219092 1:95228309-95228331 AAGTGCTTGTTGAAGAATAAAGG + Intronic
912764681 1:112397333-112397355 AAGTGTTTGAAGAAAATTCAGGG + Intronic
912895870 1:113588355-113588377 ATGTGGTTGGAGCAGAGTGATGG + Intronic
913340856 1:117756978-117757000 AAGAGGATGAAGAAGAGGGATGG + Intergenic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
917389237 1:174515657-174515679 AAGTTCCTTAAGAACAGTGATGG + Intronic
917449150 1:175132429-175132451 AAATGAGTGAAGAAAAGTGAGGG + Intronic
917694291 1:177505152-177505174 AATTGCTTGAAGATGAATGTTGG - Intergenic
918075087 1:181164743-181164765 AAGTGCTTGAAGAAATGTTTAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918714673 1:187770563-187770585 AAGTGGTTGAGGGATAGTGAGGG + Intergenic
919219059 1:194601692-194601714 AATTGCTTGAACCAGGGTGATGG - Intergenic
923120580 1:230986400-230986422 AAGTGCTGGAAGAAAAATGAAGG - Intronic
923400191 1:233609260-233609282 AGGGGCTGGAAGAAGAGAGAAGG - Intergenic
923499361 1:234551521-234551543 AATTGCTTGAACATGAGAGACGG - Intergenic
923800163 1:237201287-237201309 AAGACCTTGAATAATAGTGAGGG - Intronic
1063169537 10:3495190-3495212 AATTGCTTGAACCAGGGTGATGG - Intergenic
1063383038 10:5597981-5598003 GAGGGCTTGAAGAAGCTTGAGGG + Intergenic
1064853203 10:19734009-19734031 AGGTGCTGGAAGAAGAGTCAGGG + Intronic
1065778960 10:29149007-29149029 AAGGCCTTGCAGAAGAGTAAGGG - Intergenic
1067700027 10:48564743-48564765 AAATGCTTGCAGAAGAGAGAGGG - Intronic
1068282016 10:54885250-54885272 AAGGGCTTCAAGAAGGGGGAAGG + Intronic
1068348137 10:55811174-55811196 AAGTGGTGGAAGAAGATTTATGG + Intergenic
1068436308 10:56995434-56995456 ATGTACATGAAGAAGAGTAAAGG + Intergenic
1068666550 10:59682124-59682146 AAGTACTTGAAGGAGCTTGAGGG - Intronic
1068770886 10:60819378-60819400 AATTTTTTGTAGAAGAGTGAAGG + Intergenic
1069786013 10:70988407-70988429 AAGTAATTGAAGAAGAATGGTGG - Intergenic
1071168397 10:82833707-82833729 TAGTGCTTCAAGAATTGTGAAGG - Intronic
1071338067 10:84618002-84618024 AAAGGCTTGAAGAAGGGTAAGGG - Intergenic
1071592202 10:86885221-86885243 AAGTGATTGAAGAAAAATCAAGG + Intronic
1073700045 10:105916406-105916428 GAGTGATGGAAGAAGAGTCATGG - Intergenic
1074893273 10:117753155-117753177 CAATGTTTGCAGAAGAGTGATGG + Intergenic
1075659664 10:124184629-124184651 AAGTGCTGGCTGAAGAGTGAAGG - Intergenic
1078176040 11:8971496-8971518 AAGTGTTGGAAGAAAAGAGAAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079254748 11:18818356-18818378 TAGGGGTTGCAGAAGAGTGAAGG + Intergenic
1079779626 11:24584289-24584311 AAGTGATTGAGGAGGAGTGGAGG - Intronic
1080312512 11:30911595-30911617 GAGTGCTGGAAGAAGACTGCAGG + Intronic
1081164519 11:39791267-39791289 AAGTGGTTGAAGATGAGTATTGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084063930 11:66692736-66692758 GAGTGCTGCAAGAAGAGTGAGGG + Exonic
1084245839 11:67856407-67856429 AAGAGGTTGAAGGATAGTGAGGG + Intergenic
1084826833 11:71738107-71738129 AAGAGGTTGAAGGATAGTGAGGG - Intergenic
1086178194 11:83917953-83917975 AAGTGCATGAAGAAGAATGAAGG + Intronic
1086815862 11:91369789-91369811 AAATGCTGTAAGAAAAGTGATGG - Intergenic
1086980744 11:93195702-93195724 AAGTGGCTGAAGCAGAGTGATGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087249316 11:95878533-95878555 AAGTTTTTGCAGAAAAGTGAAGG - Intronic
1087758159 11:102076254-102076276 AAGAGCTAGATGAAGAATGAGGG - Intronic
1088144124 11:106653434-106653456 AAGTACTTGAAGCAGAGTGCTGG - Intergenic
1088897799 11:114091259-114091281 AAGTGCTTGAACCTGAGAGATGG + Intronic
1089149818 11:116356085-116356107 AAGTGCTGGCGGAAGAGAGATGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1091335514 11:134762871-134762893 AAGTGCGGGAAGGAGAGAGAAGG + Intergenic
1092977546 12:13759871-13759893 GAGTGCATGGAGCAGAGTGAGGG - Intronic
1092985307 12:13839297-13839319 AAGTACCTGAATGAGAGTGATGG + Intronic
1093272311 12:17079999-17080021 AAATGAATGAAGAAAAGTGATGG - Intergenic
1094598254 12:31884911-31884933 AAGTGCTGGCAGGAGACTGAAGG - Intergenic
1096175722 12:49516770-49516792 AATTGGTTGAAGCTGAGTGATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097398266 12:59102258-59102280 AAGAGGTTGAAGGATAGTGAGGG - Intergenic
1098036228 12:66304792-66304814 AGGTGCTTGGTGGAGAGTGAAGG + Exonic
1098949106 12:76620780-76620802 AAACCCTTGAAGAAGAGTAAGGG - Intergenic
1099097867 12:78398144-78398166 AAGTGCATGAAGAAGACTGTGGG - Intergenic
1099945342 12:89237512-89237534 AAGAGCTTGAACTAGAGTGGAGG - Intergenic
1100903827 12:99274597-99274619 AAGTGCTTCATGAAGAATGTTGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101502603 12:105318078-105318100 AATTGCTTGGAAAAGAGGGAGGG - Intronic
1101562177 12:105867366-105867388 AAGTTCTTGAAGGAAATTGAAGG + Intergenic
1101978403 12:109383283-109383305 AAGTTCTGGAGGAAGAGTAAGGG - Intronic
1103310040 12:119998503-119998525 AAGTGCTGGGTGAAAAGTGAAGG - Exonic
1103958262 12:124591819-124591841 AAGTGCCTGGAAGAGAGTGAGGG - Intergenic
1104673406 12:130695867-130695889 ATGGGCTTGAAGAGGAGTCATGG + Intronic
1105755192 13:23457369-23457391 AAGTGCTGGGAGAACAGAGAGGG + Intergenic
1106538320 13:30667489-30667511 AAATGGTTAAAGAATAGTGAAGG - Intergenic
1107478582 13:40765055-40765077 GAGTCCTTGAAAAAGAGGGAGGG + Intronic
1108159895 13:47628207-47628229 AAGTGCTTGTCTAAGAGTAAAGG - Intergenic
1108947159 13:56040884-56040906 AAGTGGTTGAGGGACAGTGAGGG - Intergenic
1109469020 13:62779916-62779938 AAGTGTTTTGAGCAGAGTGATGG + Intergenic
1110710887 13:78649658-78649680 TAGTGATGGATGAAGAGTGATGG + Intronic
1111044954 13:82802923-82802945 AAGTGCTCTAAGAACAGGGAGGG + Intergenic
1111325285 13:86686345-86686367 CAGTGATTGAAGAAGAGGGCAGG + Intergenic
1111329287 13:86743208-86743230 AAGTCCTTGAAAAAGACTGTGGG - Intergenic
1111362387 13:87191495-87191517 AAGAGGTTGAAGGATAGTGAGGG + Intergenic
1111900601 13:94195220-94195242 AACTGCTGGAAGAACAGGGAAGG - Intronic
1113038500 13:106078181-106078203 AAGTGAAGGAAGAATAGTGAAGG - Intergenic
1113205487 13:107911304-107911326 AAGGGCAATAAGAAGAGTGAAGG - Intergenic
1113976801 13:114233771-114233793 GAGTGCTGGAAGATGAGAGATGG - Intergenic
1114067617 14:19077663-19077685 AAGTGCTGAAAGAATAGAGATGG - Intergenic
1114094640 14:19322363-19322385 AAGTGCTGAAAGAATAGAGATGG + Intergenic
1114567563 14:23643830-23643852 AGGTGCTTGAAGGAGAGGGCAGG - Intronic
1115234744 14:31197936-31197958 AAGTGATTCAAGAAGAGAAAGGG - Intronic
1115522274 14:34245129-34245151 AAGTGGCTTCAGAAGAGTGATGG - Intronic
1115853553 14:37606132-37606154 AGGTGCTTGAAGAAGTCTGGAGG + Intronic
1117927460 14:60797841-60797863 AATTGCTTGAACCAGAGAGATGG + Intronic
1119021872 14:71123136-71123158 AAGTGTTTGAAGAAGAAAAAGGG + Intergenic
1120649959 14:87120110-87120132 AAGTGGTGGAAGAAGATTTATGG - Intergenic
1121229275 14:92344750-92344772 AACTGCCTGAAGATGAGTGAGGG + Intronic
1121703376 14:95973613-95973635 AAGTGGTTGAGGGATAGTGAGGG - Intergenic
1121962999 14:98278391-98278413 AAGTGCATGAAGCTGTGTGAGGG - Intergenic
1125987348 15:44067022-44067044 AAGTCCAAGAAGAAGAGGGATGG + Intronic
1126472543 15:49029343-49029365 AAATGCGTAAAGAAAAGTGAGGG - Intronic
1127953153 15:63829802-63829824 AAGTGCTTGAAAAAGGGTAGAGG + Intronic
1130730996 15:86492070-86492092 AAGTGCTCCTAGAATAGTGAGGG + Intronic
1131753556 15:95536509-95536531 AAGTGCTTGAAGCAGCCTGATGG + Intergenic
1132414316 15:101609861-101609883 AGGTCATTGAAGGAGAGTGAGGG + Intergenic
1132417541 15:101633553-101633575 CAGTCCTTGAAGAAGAAAGATGG - Intronic
1132781372 16:1628035-1628057 AACTGCTTGAATAAGGGTAAAGG - Intronic
1133073419 16:3262009-3262031 TAGTGTTTGAGGAAGAGTGGTGG + Intergenic
1133903950 16:10003820-10003842 AAGTGCTTGAGAAAGACTGTGGG + Intronic
1136138777 16:28275574-28275596 AAGTCCTGGAAAAAGAATGAGGG + Intergenic
1139492871 16:67296063-67296085 AAGTGCTGGAAGCTGTGTGAGGG + Intronic
1140211058 16:72970632-72970654 AAGTGCCAGAAGATGGGTGAAGG - Intronic
1141575619 16:84961723-84961745 AAGTGTTAGAGGAGGAGTGAAGG + Intergenic
1141905078 16:87019326-87019348 AAGTGCTTGAAGTAGGGAGGCGG + Intergenic
1143297786 17:5884027-5884049 CAATGCCTAAAGAAGAGTGAGGG - Intronic
1143931787 17:10436770-10436792 AAGTGCTAGAAGAAGAGGGTGGG - Intergenic
1144194651 17:12878690-12878712 AAGTGCTTCAGGAATAGTGAAGG + Intronic
1146478434 17:33181883-33181905 GTGTGCTTGAAGCAGAGTGAGGG + Intronic
1146657425 17:34643044-34643066 AAGTGGGAGAAGAAGAGGGAAGG + Intergenic
1148240998 17:45999207-45999229 AGGGGCTTTAAGAAGAGAGAGGG - Intronic
1149061620 17:52429274-52429296 GAGTGAATGAGGAAGAGTGAAGG - Intergenic
1150456185 17:65308666-65308688 AAGGGTTCGAAGAAGAGTGTTGG - Intergenic
1150505723 17:65696710-65696732 AACTGCTTGAAGCGGGGTGATGG + Intronic
1150997704 17:70338153-70338175 AAGTGCTTGAAGCATAGTGATGG + Intergenic
1151149467 17:72071837-72071859 CAGTGCTTTGAGAAGAGAGATGG + Intergenic
1152262703 17:79275542-79275564 AAGTCCTTGAAGGGAAGTGAAGG + Intronic
1152302943 17:79506092-79506114 AAGCGTTTGAGGAAGAGTAAGGG + Intronic
1153537197 18:6115198-6115220 AGGTGCTTAAAGCAGAGTGGTGG + Intronic
1154428664 18:14291676-14291698 AAGTCCTTGAGGAAGAGGGGTGG + Intergenic
1155274420 18:24172325-24172347 AACTGCTTGATGAAAACTGAAGG + Intronic
1156782181 18:40863741-40863763 AAGTGTTTGAAGAAGAAGGAAGG - Intergenic
1156890279 18:42183047-42183069 AGGTGGTTGAAGAAGATTTATGG - Intergenic
1157588715 18:48821698-48821720 AAGTGATTGAAGAAGATTATTGG + Intronic
1157867466 18:51198216-51198238 AAGGGCCTTAAGAAGAGTCACGG + Intronic
1158525207 18:58207124-58207146 AAGTGCTTGAAAAAGATACAAGG + Intronic
1159367909 18:67493250-67493272 AATTGCTTGAATAATATTGAGGG - Intergenic
1159845817 18:73458711-73458733 AAGTGCTTAAGGAAAAGTAAGGG + Intergenic
1160281407 18:77494166-77494188 AAGTGAGTGAAGAAGGATGATGG + Intergenic
1160305271 18:77727948-77727970 GAGTTCCTGAAGTAGAGTGAGGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164868482 19:31624713-31624735 AAGTTCTTGAAGGACAGGGAAGG - Intergenic
1165875528 19:39004021-39004043 AAGTGCTTGAGGAATGATGAGGG + Intronic
1167878713 19:52436236-52436258 AAGTGCTTAAAGAAAAATAAGGG - Intronic
925365916 2:3312112-3312134 AAGTGCCTGAAGATGAGTCTCGG + Intronic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929237732 2:39624384-39624406 AAGTACTTGGAGAAGAGTTCTGG + Intergenic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
930093133 2:47546085-47546107 AAGTTTTTGAATAAGAGAGAGGG - Intronic
930756845 2:54983626-54983648 AAGTGCTTAAAATAGAGTGATGG - Intronic
931953300 2:67389684-67389706 TGCTGCTTGAAGAAGAGTCAAGG + Intergenic
932178035 2:69620531-69620553 AAGAGCATTCAGAAGAGTGATGG - Intronic
932779988 2:74553895-74553917 AAGGGCTGGGAGAAGAGTGCTGG + Exonic
934026432 2:88005342-88005364 AGGTGCTGGAAGACCAGTGAAGG - Intergenic
934061549 2:88298767-88298789 TAATGGTTGAAGCAGAGTGATGG + Intergenic
936388617 2:112053541-112053563 AAGTTCTACAAGAAGAGTTAAGG - Intergenic
937683234 2:124667003-124667025 ATGTGCTTTAAGAAGAACGATGG + Intronic
938485258 2:131700267-131700289 AAGTGCTGAAAGAATAGAGATGG - Intergenic
938639169 2:133262468-133262490 AAGTGCTTTAAGAAGCATGTCGG - Intronic
939447544 2:142329615-142329637 AAGTGTGAGAAGAAGAGTGATGG + Intergenic
939959615 2:148554747-148554769 AAGTGCCTGAAGAAGTAAGAGGG - Intergenic
940803399 2:158157311-158157333 AAGGGCTTGATGCTGAGTGAGGG + Intergenic
940944041 2:159595915-159595937 AAGTGGTGGAAGAAGATTTATGG - Intronic
941551660 2:166923944-166923966 GAGTGATTTAAGAAGAGTCAGGG + Intronic
941650222 2:168084495-168084517 GAGGGCTTAAAGAAAAGTGAGGG + Intronic
942570965 2:177313843-177313865 AAGAGCTGGAAGAAGGCTGAGGG - Intronic
942574459 2:177348894-177348916 GAGTGCTAAAGGAAGAGTGAGGG + Intronic
942918306 2:181339483-181339505 ACTTGCTAGAAGCAGAGTGAAGG - Intergenic
945098738 2:206243997-206244019 AAGTGCTTGAGGAACACTGCGGG + Intergenic
945375821 2:209078653-209078675 AAGTGGTTGAGGGATAGTGAGGG - Intergenic
945683455 2:212940102-212940124 AAGAGCTTTAAAAAGAGAGAAGG + Intergenic
945814055 2:214582322-214582344 AAGTCCAGGAAGAAGAATGAGGG + Intergenic
947077923 2:226364509-226364531 AAATGCTTGACTGAGAGTGAAGG - Intergenic
947080062 2:226386114-226386136 AAGTGCTTATAGAAGATTTAAGG - Intergenic
947240233 2:227986610-227986632 AAGTGGTGGAAGAAAAATGAAGG - Intronic
948331420 2:237169524-237169546 AAGTCTTTGAAGAAGAGAGAGGG + Intergenic
1169489259 20:6057302-6057324 AAGTGCTAGAAGAGGAGAAAAGG - Intergenic
1170089763 20:12577855-12577877 GAGTGGTTGAGCAAGAGTGAAGG - Intergenic
1170165183 20:13354654-13354676 AAGTGCGCCAAGAAAAGTGAAGG + Intergenic
1170206353 20:13802791-13802813 AAATGCTGGGAGTAGAGTGATGG - Intronic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171999106 20:31758207-31758229 AACCGCTTGAACAAGAGTGGCGG - Intronic
1173229903 20:41186085-41186107 AATTGCTGGAAATAGAGTGATGG - Intronic
1177500317 21:21946505-21946527 AAGTGTCTGAAAAAGAGAGAGGG - Intergenic
1178632552 21:34275166-34275188 AGGTGCTTAAGGAACAGTGATGG + Intergenic
1179437924 21:41374808-41374830 AAGGGCATGAAGAAGAGGTAAGG - Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1180486092 22:15800233-15800255 AAGTGCTGAAAGAATAGAGATGG - Intergenic
1183202888 22:36398084-36398106 AAGTGCTTGGATTAGAGTCAAGG + Intergenic
1183592789 22:38790314-38790336 AAATACTTGAAGGAGAGTGGTGG + Intronic
950258251 3:11523504-11523526 AAGTGTTTGATTTAGAGTGATGG + Intronic
950763909 3:15259138-15259160 AATTCCTTGAAGTAGAATGATGG - Intronic
950908919 3:16567055-16567077 GTGTGGTTGAAGTAGAGTGAGGG - Intergenic
951060848 3:18205358-18205380 TAGTGCTTAAAGAAGAGTGAGGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951696451 3:25450105-25450127 AAATGCTTAGAGTAGAGTGAAGG + Intronic
951806146 3:26646363-26646385 ACTTGCTTGAAGGAGAGTCAGGG + Intronic
951877609 3:27444481-27444503 AAGTGACTGAAAAAGAATGAAGG - Intronic
952570332 3:34708331-34708353 AAGTGATTAAATAAGAGTTAAGG + Intergenic
954196608 3:49000882-49000904 CAGTGCTGGAAGATCAGTGAGGG - Intronic
955567409 3:60262385-60262407 CTGTGCTTGCAGAAAAGTGATGG + Intronic
956167047 3:66405021-66405043 AAGAGTTTGAAGAAGAGGGTGGG - Intronic
956312220 3:67893918-67893940 AAATACTTCAAGAAGATTGATGG - Intergenic
956960642 3:74396309-74396331 AAGTTCTTGAAGAAAATTAAAGG + Intronic
957253174 3:77801229-77801251 AAGTGGTTAAAGCAAAGTGATGG - Intergenic
957488927 3:80897996-80898018 AAGAGCTGGAAAAAGGGTGAGGG - Intergenic
957782812 3:84841706-84841728 AAATGCTCTAAGAAGAGTCAGGG - Intergenic
958191189 3:90186975-90186997 AAGGGATTCATGAAGAGTGAAGG + Intergenic
958413385 3:93846095-93846117 AAGGGATTCATGAAGAGTGAAGG + Intergenic
959081956 3:101811628-101811650 AAATGCTAGATGAAGAGTCACGG - Intronic
959472123 3:106764727-106764749 AGGTGCTTGAAGAAATGTTAAGG - Intergenic
960982354 3:123242123-123242145 AAGGGATGGAAGAAGAGTCAGGG - Intronic
961353603 3:126319971-126319993 AAGTGGTTCAAGATGAGTGGAGG + Intergenic
961597360 3:128029080-128029102 AAGACCTTGGAGAAGAGGGAAGG - Intergenic
962330086 3:134470889-134470911 AAATGCTTGAATAAGAGCAAGGG + Intergenic
963424955 3:145113653-145113675 AAGTGGTTGAGGGATAGTGAGGG - Intergenic
963640297 3:147853285-147853307 AAGTGCTTGAAGAAAAGGAGAGG + Intergenic
963970467 3:151424011-151424033 AATTTCTTGAGGAAGAGTCAAGG - Intronic
964740925 3:159965173-159965195 AAGAGCTAAAAGAAGAGTGAGGG - Intergenic
964969814 3:162545708-162545730 AAGGGCTTACAGAAGAGAGAGGG - Intergenic
966290455 3:178350418-178350440 TAGCCCTTGAAAAAGAGTGAAGG + Intergenic
966298501 3:178451970-178451992 AAGGACTTGCAGAAGACTGAAGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966690559 3:182737376-182737398 AAGTGCTGGATTAAGAGTGTAGG - Intergenic
967295645 3:187962227-187962249 AAGTGTTTAAAGAAGTATGAAGG + Intergenic
967362601 3:188648622-188648644 AAGTGATTCAAGAAGTATGAAGG - Intronic
968925951 4:3548511-3548533 AAGTGCAGGAAGAAGTGTTATGG + Intergenic
969190728 4:5516632-5516654 AAGTGCAGCAAGAATAGTGATGG + Intergenic
970414283 4:15841161-15841183 AACTGCTTAAAAATGAGTGAGGG - Intronic
970586664 4:17520929-17520951 AATTGCTTGAATCAGAGAGAAGG + Intronic
970921254 4:21397843-21397865 AAGGGATTGAAGATGGGTGATGG + Intronic
971718285 4:30209936-30209958 AAGTGCTTGAACCAGAGAGGTGG - Intergenic
971918104 4:32900997-32901019 AAATGCTTGAGGAACAGAGAAGG - Intergenic
972877681 4:43384346-43384368 AAATGCTTGATGATGAGTGTTGG + Intergenic
973149302 4:46867266-46867288 AAGGGATTGTAGAAGAGTGGAGG - Intronic
976197017 4:82542683-82542705 AAGTGGTGGAAGAAGAGAGTAGG + Intronic
976534977 4:86202297-86202319 AAGTGCTGTGAGAAGACTGAGGG - Intronic
977982699 4:103344028-103344050 AAGTGCTCGATGAGTAGTGAGGG - Intergenic
978326255 4:107560590-107560612 ACGTGGTGGAAGAAGAGTTATGG - Intergenic
978655690 4:111062814-111062836 AAGTGCATAAGGAAGAGTCAAGG - Intergenic
978668022 4:111210057-111210079 AGGTGCATGAAAAAGAGAGAAGG - Intergenic
979865649 4:125749781-125749803 AAATGATTGAAAATGAGTGACGG - Intergenic
981422798 4:144570723-144570745 CAGTGCTTGGAGCTGAGTGAGGG + Intergenic
982048592 4:151475619-151475641 AAGTGGCTGAAGTAGAGTGAGGG + Intronic
982108582 4:152032696-152032718 CAGTTCTTGAAACAGAGTGAGGG - Intergenic
983943402 4:173560028-173560050 AAGCATTTGAAGAAGATTGATGG - Intergenic
984393873 4:179169915-179169937 AAGAGGTTGAAGGATAGTGAGGG + Intergenic
984602669 4:181746255-181746277 GAGTGGTTAAAGAAGAGTGGAGG + Intergenic
985420634 4:189781785-189781807 AGGTGCTGGAAGTAGAATGAAGG + Intergenic
986300444 5:6474510-6474532 AAATGATTGATGAAGAATGAAGG - Intronic
987703496 5:21431913-21431935 AAGAGCACAAAGAAGAGTGATGG + Intergenic
988266514 5:28958544-28958566 ATATGATTGAAGAAGACTGATGG + Intergenic
988946849 5:36212150-36212172 AATTGCTTCAAGAAGAATTAAGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993884235 5:93397681-93397703 AAGGGCATAATGAAGAGTGATGG + Intergenic
994175872 5:96710443-96710465 AAGGGCAAGAAGAAGAGGGAAGG - Intronic
994412720 5:99429540-99429562 TACTGTTTGAAGGAGAGTGATGG - Intergenic
994481121 5:100336183-100336205 TACTGTTTGAAGGAGAGTGATGG + Intergenic
994874810 5:105405848-105405870 AAGTTCCTGAAGAAAAGAGAAGG + Intergenic
995492316 5:112706441-112706463 AAGTGTTTGAAGAGGAGTAGTGG + Intergenic
996133719 5:119812702-119812724 AACTGCTAGAAGTTGAGTGATGG - Intergenic
996516493 5:124375647-124375669 AAGTGATTGAGAAAGAGAGAGGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998655124 5:144170408-144170430 AAGGGCTTGAATGAGAGCGAGGG + Intronic
998919287 5:147050066-147050088 ATGTGCTTGAGTAAGAGAGAGGG + Intronic
999359874 5:150974527-150974549 TAGTTGTTGAAGCAGAGTGATGG - Intergenic
999691690 5:154151862-154151884 AAGGGCTAGAAGACAAGTGAGGG + Intronic
1001487288 5:172128655-172128677 AGGTGGTTGAGGAAGAGGGATGG + Intronic
1002392085 5:178922142-178922164 GAGTTCTCCAAGAAGAGTGATGG - Intronic
1002553754 5:180018206-180018228 AATTGCTTGAACAAGGGTGGTGG + Intronic
1002723539 5:181280646-181280668 AAGAGCGTGCAGAAGAGGGAGGG - Intergenic
1004296148 6:14413145-14413167 ACATGCTAGAAGCAGAGTGAGGG - Intergenic
1004367021 6:15021302-15021324 AACTGCTTGCAAAGGAGTGAGGG - Intergenic
1007864845 6:44956763-44956785 ATATGAATGAAGAAGAGTGATGG - Intronic
1009366300 6:62860571-62860593 AAGAGCCAGAAGAAGAGAGAGGG + Intergenic
1009898264 6:69779991-69780013 AAGGGCAAGAAGAAGAGTGCTGG - Intronic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012140868 6:95625171-95625193 AAGTGCTTCAAGGAGAAGGAAGG - Intergenic
1012190895 6:96278233-96278255 AAGATCTGGAAGAAGAGTTAAGG + Intergenic
1013029523 6:106319424-106319446 AGGTGCTAGAAGAAGAATAATGG + Intronic
1013779957 6:113718354-113718376 AAGAGATTGAAGAACAATGATGG - Intergenic
1015767521 6:136734331-136734353 AATTGCTTGAACACGAGAGACGG + Intronic
1017403200 6:154088299-154088321 AATTGCCTGAGGAATAGTGAGGG + Intronic
1020191751 7:6005289-6005311 AATTGCTTGAAGCCGAGAGACGG - Intronic
1020863184 7:13520907-13520929 AAATGTTTGTAGCAGAGTGATGG + Intergenic
1022762541 7:33371563-33371585 AAGTCCGTGAAGAAGAGAGAGGG + Intronic
1022763359 7:33381290-33381312 CAGTGATGGCAGAAGAGTGATGG + Intronic
1023107178 7:36774012-36774034 AATTGCTTGAACAAAAGAGATGG + Intergenic
1023620121 7:42062666-42062688 AATTGCTTGGATAAGAGAGAAGG + Intronic
1024198115 7:47080033-47080055 ACGTGCTTGAACTAGGGTGAAGG - Intergenic
1024204988 7:47150441-47150463 AAATAATTGCAGAAGAGTGATGG - Intergenic
1024464428 7:49696656-49696678 AAGTGTTTGAAGGAGAATGCAGG - Intergenic
1024672837 7:51612421-51612443 AAGAGGCTGAAGAAGAGGGAAGG - Intergenic
1024811841 7:53220870-53220892 AATAGCTTGTAGAAGAGGGAGGG - Intergenic
1025718196 7:63983352-63983374 CCTTGCTTGAAGAAGAGAGAGGG + Intergenic
1025753833 7:64315086-64315108 AAGAGCTTGAAAAAGAGGCAAGG - Intronic
1027581913 7:80007369-80007391 AAGTGCTTGACGAAGAATTGAGG + Intergenic
1028443867 7:90895645-90895667 AATTGCTTGAACACGAGAGACGG - Intronic
1028689910 7:93640526-93640548 AAGAGGTTGAAGGATAGTGAGGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031534725 7:122919255-122919277 AAATGCTTGAAGAAAAGGGAAGG + Intergenic
1031752175 7:125589596-125589618 ATGCGCATGAAGATGAGTGAGGG - Intergenic
1032876457 7:136043799-136043821 TTGTGATTGCAGAAGAGTGAGGG + Intergenic
1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG + Intronic
1033937697 7:146607782-146607804 AAGTGATTTAAGAAGAAAGATGG - Intronic
1034398544 7:150846327-150846349 AAGTCCCTGATGCAGAGTGAGGG - Intronic
1034527926 7:151677825-151677847 ATGTGGTGGAAGAAGATTGATGG - Intronic
1035880898 8:3243119-3243141 AAGTGGTTGAGGGATAGTGAGGG + Intronic
1037276629 8:17187204-17187226 GAGGGCTTTAAGTAGAGTGATGG + Intronic
1037498785 8:19465653-19465675 AAGTGCCTGAAGAAGAGAGACGG - Intronic
1038052903 8:23830126-23830148 CAGTGATCGAAGTAGAGTGAAGG - Intergenic
1038558002 8:28541453-28541475 AAATGCTTGAATAAGAGGGAAGG - Intronic
1039653845 8:39376554-39376576 AAGCGCTTGCTGAAAAGTGAGGG + Intergenic
1039782379 8:40797999-40798021 AAGACCCTGGAGAAGAGTGAAGG - Intronic
1040641975 8:49345715-49345737 AATTGCTTGAACCAGAGGGAAGG + Intergenic
1040899547 8:52403667-52403689 CAGTGGCTGAAGAAGAGTGCGGG - Intronic
1041974340 8:63779866-63779888 AAGTCCTGAAAGGAGAGTGAAGG - Intergenic
1042461522 8:69074590-69074612 GTGTGCTTGAAAGAGAGTGAAGG + Intergenic
1044583141 8:93842531-93842553 AAGTGCTTGATGAAAAGCAAAGG + Intergenic
1045075296 8:98559512-98559534 AAGTGGTTAAAGAAAAGTGTAGG - Intronic
1046337438 8:112808447-112808469 AAGTCCTTGAAGAAAAGTGGGGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1052313127 9:27090172-27090194 AAGTTGTTCAAGAAGAGTGGGGG - Intergenic
1052715968 9:32117459-32117481 AAATGCTTTAAGAAGAGACAAGG - Intergenic
1054464049 9:65482108-65482130 AAGTGCAGGAAGAAGTGTTATGG - Intergenic
1055100897 9:72464311-72464333 AAGTGCATGTAGAGGAGTAATGG - Intergenic
1055875390 9:80935742-80935764 AAGAGATTGAAGGAGAGTGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056254370 9:84783656-84783678 AAGAGCATGGAGAAGAGAGAGGG + Intronic
1057126796 9:92622829-92622851 ATATGCTTGAAGAAGACAGAAGG + Intronic
1057610904 9:96542919-96542941 AATTGCTTGAACAAGAGAGATGG + Intronic
1057967406 9:99517679-99517701 AGGGGCTTGGAGAAGAGGGAGGG - Intergenic
1058171908 9:101691995-101692017 AAGTGCCTGGCGCAGAGTGAGGG + Intronic
1059547593 9:115193873-115193895 AAGTGTTTGGGGAAGAGTGTTGG + Intronic
1059574304 9:115473815-115473837 AAGAGGTTGAAGGATAGTGAGGG - Intergenic
1059606981 9:115844274-115844296 AAGTGGTTGAGGGACAGTGAGGG + Intergenic
1060257632 9:122046661-122046683 AAGTGTCTGAAGAAGAGAAAAGG - Intronic
1060460017 9:123843114-123843136 AAGTTCTCCAAGAAGAATGATGG - Intronic
1060623866 9:125092637-125092659 ATGTCCTTGAATAACAGTGAGGG - Intronic
1061069297 9:128299092-128299114 GACTGCTGGAAGAAGAGTGCGGG + Intergenic
1062442855 9:136578899-136578921 AAGTGCTTGTGGGAAAGTGAGGG + Intergenic
1062649634 9:137568989-137569011 AAGTGCTTTAAGATGACAGAGGG - Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1185818231 X:3176587-3176609 AAGTGCTTAATGAACAGTGAAGG + Intergenic
1185862523 X:3592438-3592460 AAGGGCAAGAAGAAGAGGGAGGG + Intergenic
1185960998 X:4545668-4545690 AAGTGGTTGAGGGATAGTGAGGG + Intergenic
1186034141 X:5402905-5402927 AATTGCTTGAACAAGGGAGACGG - Intergenic
1186457600 X:9722255-9722277 AAGTTCTTGAAGAAGTGAGAAGG - Intergenic
1186684133 X:11906811-11906833 GAGTGCTAGAAGAAGAAAGAAGG - Intergenic
1187187812 X:17003882-17003904 AAGTTCTGGAAGAAGGTTGAAGG - Intronic
1187328977 X:18318323-18318345 AAGCTTTTGAAGAAGATTGAAGG - Intronic
1187917784 X:24171413-24171435 AAGTGCTTGAAGGAAAGTTAGGG + Intronic
1188622988 X:32249463-32249485 AAGTGCTTGAGGAAGAGACCAGG + Intronic
1190547073 X:51538683-51538705 AAATGCTTGATGTGGAGTGATGG - Intergenic
1190551827 X:51590762-51590784 AAATGCTTGATGTGGAGTGATGG + Intergenic
1191867987 X:65721107-65721129 AAGTTCCTGAAGAACAGAGATGG - Intronic
1192608149 X:72541354-72541376 CAGTGCCTGAAGAACAGTGAGGG + Intronic
1193805919 X:85994344-85994366 AATTGCTTGCAGAAGTGTGCTGG - Intronic
1193941178 X:87682312-87682334 AAGAGCTTGAGGGATAGTGAGGG - Intergenic
1194675070 X:96784707-96784729 AAAAGTTTGAAGAACAGTGAGGG + Intronic
1194898353 X:99473627-99473649 AAGTGGCTGAAGAAGGGTGAAGG - Intergenic
1195005319 X:100679966-100679988 AATAGCTTGAAGAAGAGATAAGG - Intronic
1196416247 X:115474868-115474890 AAGTGGTTGAGGGAGAGTGAAGG - Intergenic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1198119661 X:133579457-133579479 AAATGCTTGAAGCATATTGACGG + Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200767980 Y:7096857-7096879 AAGTTCTTGAAGAGGTATGAGGG - Intergenic
1201253798 Y:12087671-12087693 ATGTGCTTAAAGAAAAGTTATGG - Intergenic
1201262374 Y:12172567-12172589 AAGTACTTAATGAACAGTGAAGG - Intergenic
1202031276 Y:20576632-20576654 AATTGCTTGAAGAAAACTGTAGG + Intronic