ID: 1090331567 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:125936391-125936413 |
| Sequence | CCACAGAGACAGAAGGTAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1090331567_1090331570 | -7 | Left | 1090331567 | 11:125936391-125936413 | CCTTCTACCTTCTGTCTCTGTGG | No data | ||
| Right | 1090331570 | 11:125936407-125936429 | TCTGTGGTTTTGACTGCTCTAGG | No data | ||||
| 1090331567_1090331571 | 9 | Left | 1090331567 | 11:125936391-125936413 | CCTTCTACCTTCTGTCTCTGTGG | No data | ||
| Right | 1090331571 | 11:125936423-125936445 | CTCTAGGTATCTCATCTAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1090331567 | Original CRISPR | CCACAGAGACAGAAGGTAGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||