ID: 1090331567

View in Genome Browser
Species Human (GRCh38)
Location 11:125936391-125936413
Sequence CCACAGAGACAGAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090331567_1090331570 -7 Left 1090331567 11:125936391-125936413 CCTTCTACCTTCTGTCTCTGTGG No data
Right 1090331570 11:125936407-125936429 TCTGTGGTTTTGACTGCTCTAGG No data
1090331567_1090331571 9 Left 1090331567 11:125936391-125936413 CCTTCTACCTTCTGTCTCTGTGG No data
Right 1090331571 11:125936423-125936445 CTCTAGGTATCTCATCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090331567 Original CRISPR CCACAGAGACAGAAGGTAGA AGG (reversed) Intergenic
No off target data available for this crispr