ID: 1090332235

View in Genome Browser
Species Human (GRCh38)
Location 11:125941382-125941404
Sequence CTCCGGGAATGGAAAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090332229_1090332235 2 Left 1090332229 11:125941357-125941379 CCAGGTAGGGCTGGTTGAGAAAG No data
Right 1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG No data
1090332227_1090332235 10 Left 1090332227 11:125941349-125941371 CCACATGCCCAGGTAGGGCTGGT No data
Right 1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG No data
1090332222_1090332235 26 Left 1090332222 11:125941333-125941355 CCATGAGTGTTTTGCTCCACATG No data
Right 1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG No data
1090332228_1090332235 3 Left 1090332228 11:125941356-125941378 CCCAGGTAGGGCTGGTTGAGAAA No data
Right 1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090332235 Original CRISPR CTCCGGGAATGGAAAGCAGA TGG Intergenic
No off target data available for this crispr