ID: 1090332648

View in Genome Browser
Species Human (GRCh38)
Location 11:125943763-125943785
Sequence CCCTGCTGCCTCGGGAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090332648_1090332654 -10 Left 1090332648 11:125943763-125943785 CCTCACCTCCCGAGGCAGCAGGG No data
Right 1090332654 11:125943776-125943798 GGCAGCAGGGACAGGAGCCCTGG No data
1090332648_1090332655 -9 Left 1090332648 11:125943763-125943785 CCTCACCTCCCGAGGCAGCAGGG No data
Right 1090332655 11:125943777-125943799 GCAGCAGGGACAGGAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090332648 Original CRISPR CCCTGCTGCCTCGGGAGGTG AGG (reversed) Intergenic
No off target data available for this crispr