ID: 1090332882

View in Genome Browser
Species Human (GRCh38)
Location 11:125945013-125945035
Sequence TCCTGAACCCCAGTGAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090332882_1090332888 14 Left 1090332882 11:125945013-125945035 CCCCTTCTCACTGGGGTTCAGGA No data
Right 1090332888 11:125945050-125945072 CTAACCCTGCCACCAGAGGATGG No data
1090332882_1090332887 10 Left 1090332882 11:125945013-125945035 CCCCTTCTCACTGGGGTTCAGGA No data
Right 1090332887 11:125945046-125945068 CCGTCTAACCCTGCCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090332882 Original CRISPR TCCTGAACCCCAGTGAGAAG GGG (reversed) Intergenic