ID: 1090332888

View in Genome Browser
Species Human (GRCh38)
Location 11:125945050-125945072
Sequence CTAACCCTGCCACCAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090332883_1090332888 13 Left 1090332883 11:125945014-125945036 CCCTTCTCACTGGGGTTCAGGAA No data
Right 1090332888 11:125945050-125945072 CTAACCCTGCCACCAGAGGATGG No data
1090332880_1090332888 15 Left 1090332880 11:125945012-125945034 CCCCCTTCTCACTGGGGTTCAGG No data
Right 1090332888 11:125945050-125945072 CTAACCCTGCCACCAGAGGATGG No data
1090332884_1090332888 12 Left 1090332884 11:125945015-125945037 CCTTCTCACTGGGGTTCAGGAAT No data
Right 1090332888 11:125945050-125945072 CTAACCCTGCCACCAGAGGATGG No data
1090332876_1090332888 28 Left 1090332876 11:125944999-125945021 CCGGACATCAGATCCCCCTTCTC No data
Right 1090332888 11:125945050-125945072 CTAACCCTGCCACCAGAGGATGG No data
1090332882_1090332888 14 Left 1090332882 11:125945013-125945035 CCCCTTCTCACTGGGGTTCAGGA No data
Right 1090332888 11:125945050-125945072 CTAACCCTGCCACCAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090332888 Original CRISPR CTAACCCTGCCACCAGAGGA TGG Intergenic