ID: 1090333273

View in Genome Browser
Species Human (GRCh38)
Location 11:125947259-125947281
Sequence CTCCAGGGTCACCATCGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090333264_1090333273 12 Left 1090333264 11:125947224-125947246 CCCCGAGCCACCAGTGGCCAAGC No data
Right 1090333273 11:125947259-125947281 CTCCAGGGTCACCATCGTCACGG No data
1090333269_1090333273 -5 Left 1090333269 11:125947241-125947263 CCAAGCAGATCTCCTTATCTCCA No data
Right 1090333273 11:125947259-125947281 CTCCAGGGTCACCATCGTCACGG No data
1090333263_1090333273 17 Left 1090333263 11:125947219-125947241 CCAGACCCCGAGCCACCAGTGGC No data
Right 1090333273 11:125947259-125947281 CTCCAGGGTCACCATCGTCACGG No data
1090333266_1090333273 10 Left 1090333266 11:125947226-125947248 CCGAGCCACCAGTGGCCAAGCAG No data
Right 1090333273 11:125947259-125947281 CTCCAGGGTCACCATCGTCACGG No data
1090333265_1090333273 11 Left 1090333265 11:125947225-125947247 CCCGAGCCACCAGTGGCCAAGCA No data
Right 1090333273 11:125947259-125947281 CTCCAGGGTCACCATCGTCACGG No data
1090333268_1090333273 2 Left 1090333268 11:125947234-125947256 CCAGTGGCCAAGCAGATCTCCTT No data
Right 1090333273 11:125947259-125947281 CTCCAGGGTCACCATCGTCACGG No data
1090333267_1090333273 5 Left 1090333267 11:125947231-125947253 CCACCAGTGGCCAAGCAGATCTC No data
Right 1090333273 11:125947259-125947281 CTCCAGGGTCACCATCGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090333273 Original CRISPR CTCCAGGGTCACCATCGTCA CGG Intergenic
No off target data available for this crispr