ID: 1090334193

View in Genome Browser
Species Human (GRCh38)
Location 11:125951768-125951790
Sequence ATGGCCCTGTGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090334193_1090334205 16 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334205 11:125951807-125951829 TTCCAGGGGAGCCTCTCGGGAGG No data
1090334193_1090334198 0 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334198 11:125951791-125951813 ACTGAGCCATCATTCCTTCCAGG No data
1090334193_1090334203 13 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG No data
1090334193_1090334202 12 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334202 11:125951803-125951825 TTCCTTCCAGGGGAGCCTCTCGG No data
1090334193_1090334199 1 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334199 11:125951792-125951814 CTGAGCCATCATTCCTTCCAGGG No data
1090334193_1090334208 28 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data
1090334193_1090334200 2 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334200 11:125951793-125951815 TGAGCCATCATTCCTTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090334193 Original CRISPR ATGGCCCTGTGGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr