ID: 1090334200

View in Genome Browser
Species Human (GRCh38)
Location 11:125951793-125951815
Sequence TGAGCCATCATTCCTTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090334193_1090334200 2 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334200 11:125951793-125951815 TGAGCCATCATTCCTTCCAGGGG No data
1090334189_1090334200 8 Left 1090334189 11:125951762-125951784 CCAAGCCCTTCCTCCTTCCACAG No data
Right 1090334200 11:125951793-125951815 TGAGCCATCATTCCTTCCAGGGG No data
1090334196_1090334200 -9 Left 1090334196 11:125951779-125951801 CCACAGGGCCATACTGAGCCATC No data
Right 1090334200 11:125951793-125951815 TGAGCCATCATTCCTTCCAGGGG No data
1090334195_1090334200 -5 Left 1090334195 11:125951775-125951797 CCTTCCACAGGGCCATACTGAGC No data
Right 1090334200 11:125951793-125951815 TGAGCCATCATTCCTTCCAGGGG No data
1090334194_1090334200 -2 Left 1090334194 11:125951772-125951794 CCTCCTTCCACAGGGCCATACTG No data
Right 1090334200 11:125951793-125951815 TGAGCCATCATTCCTTCCAGGGG No data
1090334192_1090334200 3 Left 1090334192 11:125951767-125951789 CCCTTCCTCCTTCCACAGGGCCA No data
Right 1090334200 11:125951793-125951815 TGAGCCATCATTCCTTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090334200 Original CRISPR TGAGCCATCATTCCTTCCAG GGG Intergenic
No off target data available for this crispr