ID: 1090334203

View in Genome Browser
Species Human (GRCh38)
Location 11:125951804-125951826
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090334189_1090334203 19 Left 1090334189 11:125951762-125951784 CCAAGCCCTTCCTCCTTCCACAG No data
Right 1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG No data
1090334193_1090334203 13 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG No data
1090334197_1090334203 -6 Left 1090334197 11:125951787-125951809 CCATACTGAGCCATCATTCCTTC No data
Right 1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG No data
1090334195_1090334203 6 Left 1090334195 11:125951775-125951797 CCTTCCACAGGGCCATACTGAGC No data
Right 1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG No data
1090334194_1090334203 9 Left 1090334194 11:125951772-125951794 CCTCCTTCCACAGGGCCATACTG No data
Right 1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG No data
1090334192_1090334203 14 Left 1090334192 11:125951767-125951789 CCCTTCCTCCTTCCACAGGGCCA No data
Right 1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG No data
1090334196_1090334203 2 Left 1090334196 11:125951779-125951801 CCACAGGGCCATACTGAGCCATC No data
Right 1090334203 11:125951804-125951826 TCCTTCCAGGGGAGCCTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090334203 Original CRISPR TCCTTCCAGGGGAGCCTCTC GGG Intergenic