ID: 1090334208

View in Genome Browser
Species Human (GRCh38)
Location 11:125951819-125951841
Sequence CTCTCGGGAGGCCTACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090334201_1090334208 -1 Left 1090334201 11:125951797-125951819 CCATCATTCCTTCCAGGGGAGCC No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data
1090334204_1090334208 -9 Left 1090334204 11:125951805-125951827 CCTTCCAGGGGAGCCTCTCGGGA No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data
1090334194_1090334208 24 Left 1090334194 11:125951772-125951794 CCTCCTTCCACAGGGCCATACTG No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data
1090334196_1090334208 17 Left 1090334196 11:125951779-125951801 CCACAGGGCCATACTGAGCCATC No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data
1090334197_1090334208 9 Left 1090334197 11:125951787-125951809 CCATACTGAGCCATCATTCCTTC No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data
1090334195_1090334208 21 Left 1090334195 11:125951775-125951797 CCTTCCACAGGGCCATACTGAGC No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data
1090334192_1090334208 29 Left 1090334192 11:125951767-125951789 CCCTTCCTCCTTCCACAGGGCCA No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data
1090334193_1090334208 28 Left 1090334193 11:125951768-125951790 CCTTCCTCCTTCCACAGGGCCAT No data
Right 1090334208 11:125951819-125951841 CTCTCGGGAGGCCTACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090334208 Original CRISPR CTCTCGGGAGGCCTACCTGC TGG Intergenic
No off target data available for this crispr