ID: 1090339011

View in Genome Browser
Species Human (GRCh38)
Location 11:125998829-125998851
Sequence GACAATCAAGTTTCTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090339010_1090339011 -2 Left 1090339010 11:125998808-125998830 CCAGTGATCTTTTGGCATGCTGA 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1090339011 11:125998829-125998851 GACAATCAAGTTTCTAGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 96
1090339008_1090339011 13 Left 1090339008 11:125998793-125998815 CCGGTTTTTGAGAGACCAGTGAT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1090339011 11:125998829-125998851 GACAATCAAGTTTCTAGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090339011 Original CRISPR GACAATCAAGTTTCTAGAGC TGG Intronic
905610100 1:39343032-39343054 GAAAAGCAACTCTCTAGAGCAGG - Intronic
907571381 1:55487326-55487348 CACAATCATGTTTCTATACCTGG - Intergenic
909213039 1:72848693-72848715 GAGAATCAAGTTTCTAACTCTGG - Intergenic
919076437 1:192819267-192819289 GCCAAGCAAGATTTTAGAGCTGG - Intergenic
919373926 1:196768098-196768120 GACAATTAACATTGTAGAGCAGG + Intergenic
922032911 1:221821580-221821602 GACAAACAAGTCTCTGGAGATGG - Intergenic
1064694548 10:17952371-17952393 AAGAATCAAGATTCTAGAGCAGG - Intronic
1067380358 10:45767623-45767645 GACAGCCAAGGTTCTAGAACAGG + Intronic
1067668524 10:48299449-48299471 GAAAACCAAGTATCAAGAGCTGG - Intergenic
1067888061 10:50108278-50108300 GACAGCCAAGGTTCTAGAACAGG + Intronic
1068251687 10:54450516-54450538 GATAATAAAATTTCTAAAGCAGG + Intronic
1070106453 10:73436723-73436745 GAAAATCCTGTTACTAGAGCTGG - Intronic
1070528597 10:77316625-77316647 TACAAGCAAGGCTCTAGAGCTGG + Intronic
1072226349 10:93373540-93373562 GATAATCCAGCTTCCAGAGCTGG + Intronic
1073593167 10:104775733-104775755 GGCATTTATGTTTCTAGAGCTGG + Intronic
1073919568 10:108443366-108443388 GACCCTCAAGTTTCAACAGCTGG - Intergenic
1074869983 10:117568730-117568752 GACAATCGAGTGTCTTGACCTGG - Intergenic
1077269321 11:1667685-1667707 TGCAATCAAGTCTCTAGAGCGGG - Intergenic
1080046144 11:27810231-27810253 GGCCATCAAGTTTTTAGGGCAGG + Intergenic
1081068844 11:38583878-38583900 GAAAATCAAGTGTCAGGAGCTGG + Intergenic
1088415608 11:109585884-109585906 AATAAACAACTTTCTAGAGCAGG + Intergenic
1090339011 11:125998829-125998851 GACAATCAAGTTTCTAGAGCTGG + Intronic
1091363639 11:134999313-134999335 AACATTCAAGGTCCTAGAGCAGG + Intergenic
1095654036 12:44648525-44648547 GTCAACGAAGTTTCTAGAGAGGG + Intronic
1101165344 12:102024510-102024532 GATTATCAAGTTGCTAGTGCAGG + Intronic
1105357894 13:19676401-19676423 GAGATTTAACTTTCTAGAGCTGG + Intronic
1106980944 13:35279055-35279077 GAAAATCAATTCTCCAGAGCTGG - Intronic
1108516812 13:51211355-51211377 GACAATCTATTTTCTATACCAGG - Intergenic
1108757734 13:53524094-53524116 GACAATTAAGTTTCTGTATCAGG + Intergenic
1111054187 13:82926264-82926286 GCCCATCAAGTTTCTAAATCAGG + Intergenic
1116907684 14:50420972-50420994 GAGAAAAAAGTTTCTAGAGGAGG + Intronic
1118558342 14:67051074-67051096 GACAACCAAGTTCCTAGGGGAGG + Intronic
1120060428 14:79976294-79976316 GACAATCAAATTTGCAGTGCTGG + Intergenic
1125207207 15:37167333-37167355 AACAATAAGGCTTCTAGAGCAGG + Intergenic
1125817172 15:42595932-42595954 CACAGTCAAGTTTCTAAAGACGG - Intronic
1134491656 16:14700418-14700440 CAAAATCATGTTTCTAGTGCTGG - Intergenic
1134497037 16:14739536-14739558 CAAAATCATGTTTCTAGTGCTGG - Intronic
1135780129 16:25292841-25292863 GAGCAACAAGTGTCTAGAGCAGG - Intergenic
1137009420 16:35308573-35308595 GAGAATCAAGTTTGAAGAGGGGG + Intergenic
1140898253 16:79344575-79344597 TTCAATCAAGTCTCTAGAGGAGG + Intergenic
1141001692 16:80314380-80314402 GCCATTCCAGTTTCTGGAGCTGG - Intergenic
1141575878 16:84963363-84963385 GAGAATCCAGATTCTAGAGGAGG - Intergenic
1149491687 17:57089622-57089644 GACAATTAAGCTTTTAGAGTTGG - Intronic
1159161144 18:64645090-64645112 CAAAATCAAGTTTCTGGACCTGG + Intergenic
1166684095 19:44784890-44784912 ATCAATCTAGATTCTAGAGCAGG - Intronic
927035342 2:19169357-19169379 GACAATCATGTTTCCAGACTGGG - Intergenic
928730569 2:34227072-34227094 GATAAACAAGTTTTTAGAACTGG - Intergenic
930729526 2:54714047-54714069 AAGAATCAGGATTCTAGAGCTGG - Intergenic
932084134 2:68743076-68743098 GACAATGACATTTCTACAGCAGG - Intronic
932776691 2:74532197-74532219 GTAAATCAACTTTCTAGACCTGG + Intronic
934905796 2:98201371-98201393 TACAACAAAGTTCCTAGAGCAGG - Intronic
937203363 2:120220091-120220113 GGCACTCAGGTTCCTAGAGCTGG + Intergenic
939556623 2:143682026-143682048 GTCAAACAAATTTGTAGAGCTGG + Intronic
944926398 2:204469299-204469321 GTCAGTCAAGTTCCAAGAGCTGG + Intergenic
947240395 2:227988311-227988333 TAGAATTAAGTTTCTTGAGCTGG + Intronic
1170284518 20:14691614-14691636 GGAAATGCAGTTTCTAGAGCAGG + Intronic
1173791733 20:45832493-45832515 GACAGTAAAGTGCCTAGAGCAGG + Intronic
1174740031 20:53003961-53003983 GACACTGAAGCTTCTAGAACAGG - Intronic
1179842085 21:44083326-44083348 GACTTTCAAGTTTGTAAAGCAGG + Intronic
1181443558 22:22951342-22951364 GACAAGCAAGTGTCATGAGCAGG + Intergenic
1181689736 22:24552171-24552193 AAGAATTAAATTTCTAGAGCTGG + Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
956924263 3:73966751-73966773 CACAACCCAGTTTCTAGAACTGG + Intergenic
964415914 3:156447210-156447232 GAGAATCAATTTTATAAAGCAGG - Intronic
965200461 3:165650214-165650236 GAGAAAGAAGTTTGTAGAGCAGG + Intergenic
970009099 4:11439130-11439152 TAGAAACAAGTTTCTAGGGCTGG + Intergenic
974959239 4:68677382-68677404 GACTCGCAGGTTTCTAGAGCCGG - Intergenic
977475976 4:97510036-97510058 GGCTATAGAGTTTCTAGAGCCGG + Intronic
978838375 4:113181107-113181129 CAGAATGAAGTTTTTAGAGCTGG - Intronic
982532437 4:156562477-156562499 GACAACCAAGATTCTAGGCCAGG + Intergenic
982541912 4:156682940-156682962 GACAATCAAGATTCTAGGCCAGG - Intergenic
984445974 4:179836350-179836372 GAGAATTAACTCTCTAGAGCTGG + Intergenic
985207763 4:187558672-187558694 GACAATGAAGTCTCTATTGCAGG - Intergenic
991144099 5:63281140-63281162 GGCAGTCAAGATTCAAGAGCAGG + Intergenic
993719790 5:91311039-91311061 AACAAACAAGTATTTAGAGCAGG + Intergenic
994214351 5:97120741-97120763 GGCAATAAAGATTCTACAGCTGG - Intronic
995962856 5:117864960-117864982 TCAAATCAAGTTTCTAAAGCTGG + Intergenic
998414488 5:141936385-141936407 GACAATCGAGGATCCAGAGCTGG + Intronic
1000507769 5:162143075-162143097 CACAATCAACTTTCATGAGCTGG - Intronic
1000603803 5:163306146-163306168 AACAATCCATTTTCTAAAGCTGG + Intergenic
1001758869 5:174191406-174191428 GACAGTCCAGTTTCTATAACAGG - Intronic
1002209919 5:177592464-177592486 GACAGTCAGCTCTCTAGAGCCGG + Intronic
1004352905 6:14906169-14906191 GGCAATCAAGTTTGGAGAGCAGG + Intergenic
1004928240 6:20436332-20436354 TAAAATCAAGATTCTAGATCGGG + Intronic
1005391400 6:25337477-25337499 GACATTCAATTTTTTAGAGTTGG - Intronic
1007082834 6:39120784-39120806 GATAATGATGTGTCTAGAGCAGG + Intergenic
1011836288 6:91435430-91435452 TACAAGCAAATTTCTACAGCAGG - Intergenic
1018541438 6:164884139-164884161 GACATGCAATTTTCTAGAGTTGG - Intergenic
1024211325 7:47208165-47208187 GCAAGTCAAGTTTATAGAGCAGG + Intergenic
1024818579 7:53300337-53300359 GGCAAACAAGTTTTTAGATCTGG - Intergenic
1029997701 7:105024568-105024590 ACCAATCAAGTTTTTAGAGTAGG + Intronic
1032711791 7:134467225-134467247 GACTGGCAGGTTTCTAGAGCCGG - Intergenic
1035483451 7:159204399-159204421 GACTGTCAAGTGTTTAGAGCTGG + Intergenic
1039619092 8:38980341-38980363 GACAATGAGTTTACTAGAGCAGG + Intronic
1041681844 8:60601854-60601876 CACAATGAAGTTGATAGAGCTGG + Intronic
1042635973 8:70875395-70875417 TAAAATCAACTTTATAGAGCAGG + Intergenic
1052961949 9:34306127-34306149 GAAAATCAAGTTTCTGGTTCGGG - Intronic
1056432423 9:86540816-86540838 GAGAAACATGTTTCTAGAGAAGG + Intergenic
1188211074 X:27424632-27424654 GAAAATCAAATTTCAAGGGCAGG - Intergenic
1195859481 X:109367746-109367768 AACATTGAAGTTTCTGGAGCAGG + Intergenic
1197564646 X:128067275-128067297 GAAAATCAGATATCTAGAGCAGG + Intergenic