ID: 1090339976

View in Genome Browser
Species Human (GRCh38)
Location 11:126009228-126009250
Sequence CTCCAGCTTCATTCAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090339970_1090339976 3 Left 1090339970 11:126009202-126009224 CCTGGTCTCCACCACTTCTCCTC 0: 1
1: 0
2: 5
3: 52
4: 836
Right 1090339976 11:126009228-126009250 CTCCAGCTTCATTCAGAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 209
1090339971_1090339976 -5 Left 1090339971 11:126009210-126009232 CCACCACTTCTCCTCCGCCTCCA 0: 1
1: 0
2: 11
3: 124
4: 1242
Right 1090339976 11:126009228-126009250 CTCCAGCTTCATTCAGAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 209
1090339969_1090339976 4 Left 1090339969 11:126009201-126009223 CCCTGGTCTCCACCACTTCTCCT 0: 1
1: 0
2: 4
3: 41
4: 611
Right 1090339976 11:126009228-126009250 CTCCAGCTTCATTCAGAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 209
1090339972_1090339976 -8 Left 1090339972 11:126009213-126009235 CCACTTCTCCTCCGCCTCCAGCT 0: 1
1: 0
2: 11
3: 207
4: 1624
Right 1090339976 11:126009228-126009250 CTCCAGCTTCATTCAGAGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090339976 Original CRISPR CTCCAGCTTCATTCAGAGCA AGG Intronic
900126386 1:1070687-1070709 CTTCAGCTTGGTTCAGAGCCCGG - Intergenic
900535760 1:3176411-3176433 GTCCTGCCTCTTTCAGAGCAGGG + Intronic
906013524 1:42552314-42552336 GTACAGCCACATTCAGAGCATGG - Intronic
910058435 1:83059902-83059924 TTGCAGCTTGATTCTGAGCATGG + Intergenic
912746357 1:112248655-112248677 GCCCAGCTTCATTCAGACCCAGG - Intergenic
914751176 1:150536096-150536118 TTCCAGCTTCATTCAGCACTTGG - Intergenic
914885735 1:151582890-151582912 CTGCAGGGTCATTCAGAGCCAGG - Exonic
916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG + Intronic
917209567 1:172617580-172617602 TTCCAGCATAATTAAGAGCATGG - Intergenic
918011983 1:180595448-180595470 TTTCAGCTTCTTTTAGAGCAGGG - Intergenic
919481116 1:198091194-198091216 CTCCAACTTCAGTGAAAGCAGGG - Intergenic
920431508 1:205921900-205921922 CCCCTGCTTCAGTCACAGCAAGG - Intronic
920568849 1:207001003-207001025 TTCCAGCTTGATTAACAGCAGGG - Intergenic
923751975 1:236754682-236754704 CCCCAGCCTCCTCCAGAGCAGGG + Intronic
1062893878 10:1088129-1088151 CTGCAGCCTAATTCAGAGCAGGG - Intronic
1066458846 10:35595657-35595679 CTCCAGCATCACACAGAGCAAGG - Intergenic
1066535418 10:36385655-36385677 GTGGAGCTTCATTCAGAGGAGGG + Intergenic
1066681262 10:37938556-37938578 CTTCAGATTCATCCACAGCAGGG - Intergenic
1070596193 10:77834726-77834748 CCCCAGCCTCAGTCAGAGCCTGG + Intronic
1070600274 10:77861438-77861460 CTCCAGCTTCTTTGAAAGCCAGG - Intronic
1071687291 10:87773005-87773027 CTCCAGCTTCATCTGGAGGAGGG + Intronic
1072324524 10:94284630-94284652 CTCCATCTTCCCTCAGTGCATGG - Intronic
1072828142 10:98629212-98629234 CTCCAGCTTCATTTGGAGGGTGG - Intronic
1073327845 10:102652568-102652590 CTCCACCTTCCTTCAGAGGCAGG - Intronic
1074365423 10:112854029-112854051 CTCTAGGTTCATGCTGAGCAGGG - Intergenic
1074376856 10:112947978-112948000 ATCCAACTTAATTCAGACCAGGG + Intergenic
1075035870 10:119066669-119066691 GTCAGGCTGCATTCAGAGCATGG + Intronic
1075165200 10:120062026-120062048 CCACAGCTTCATTCTGAACAGGG - Intergenic
1075391345 10:122094809-122094831 GGCCAGTTTCATTCAGATCAAGG + Intronic
1077347270 11:2068466-2068488 CTTAAGCCTTATTCAGAGCAAGG - Intergenic
1079239027 11:18709438-18709460 CCCCAGCCTCATTCACAGCCCGG + Exonic
1079749680 11:24181607-24181629 CTCATGATCCATTCAGAGCATGG - Intergenic
1080519532 11:33055517-33055539 CTCCAGGTTCACTTATAGCAAGG - Intronic
1082649326 11:55769039-55769061 CTCCAGCTTCATTCATGTCCTGG + Intergenic
1083833740 11:65250590-65250612 CTGCAGCTGTATTCAGAGGAGGG - Intergenic
1084658402 11:70532765-70532787 CCCCAGAATAATTCAGAGCAGGG + Intronic
1085261406 11:75207352-75207374 CTCAAGCTGCATTCACATCACGG + Intergenic
1086421670 11:86643733-86643755 CTCTAGGTTCCTTGAGAGCAAGG + Intronic
1086838707 11:91657988-91658010 CTCTAGCTTCATTCAGATTCTGG - Intergenic
1088662089 11:112057591-112057613 CCAAAGCTTAATTCAGAGCAAGG + Intronic
1089025369 11:115264173-115264195 TTCCAGCTACATTAAGACCAAGG + Intronic
1089299596 11:117490597-117490619 CTCCAGCTTCATTCTTACTAAGG + Intronic
1089639801 11:119840124-119840146 CTTCTGATTCATTCACAGCAAGG - Intergenic
1090339976 11:126009228-126009250 CTCCAGCTTCATTCAGAGCAAGG + Intronic
1090772574 11:129934195-129934217 CTCCAGCTTCATTCAGCTGCAGG - Intronic
1091119743 11:133046981-133047003 TTCCAGCTCCATTCCCAGCAGGG - Intronic
1091128026 11:133119380-133119402 CTCCAGGTTCATTCAAATCAGGG - Intronic
1092009039 12:5094305-5094327 CTCCAGCTTGATTGTGATCAAGG - Intergenic
1092064969 12:5582383-5582405 CTCCAGCTTCAGGCAGTGTAGGG - Intronic
1092992063 12:13912584-13912606 CTTCAGGTTCAGACAGAGCAAGG - Intronic
1099119176 12:78666158-78666180 CTAAAGCCTAATTCAGAGCAAGG - Intergenic
1101529115 12:105558209-105558231 CTCCTGCTTCTCTCAGTGCATGG - Intergenic
1102161541 12:110773074-110773096 TTCCAGCTTCATTCATTTCAAGG - Intergenic
1102161643 12:110774072-110774094 CTCCATATTAATTCAGAGCAGGG + Intergenic
1102207565 12:111100943-111100965 CCCCAGCTCCAGTCAGAGCCTGG + Intronic
1102455320 12:113067214-113067236 CTCCAACTGCAAGCAGAGCACGG + Intronic
1106869589 13:34004438-34004460 TTCCTGCTACATTCAAAGCATGG - Intergenic
1106915568 13:34510472-34510494 CTACAGGTTGATTTAGAGCAAGG - Intergenic
1109379136 13:61535554-61535576 CAGCTGCTTCATGCAGAGCAGGG - Intergenic
1110044834 13:70814330-70814352 CTCCAGCTTCTTTCACAGACTGG - Intergenic
1110178500 13:72586767-72586789 GTCCTGCTCCATCCAGAGCAAGG + Intergenic
1115542152 14:34431027-34431049 CTAAAGCCTAATTCAGAGCAAGG + Intronic
1116043737 14:39717508-39717530 TTCCAGCTTCATACAGCGAATGG + Intergenic
1119712340 14:76831279-76831301 CTCCTACTTCATTCGGAACATGG + Exonic
1119888834 14:78167309-78167331 CTCCATCTTCACTCAGTTCAGGG - Intergenic
1121051837 14:90824283-90824305 GTCCAGCCTCATTCTGGGCAGGG - Intergenic
1121348019 14:93150425-93150447 TTGCAGCAGCATTCAGAGCAAGG + Intergenic
1121695330 14:95907916-95907938 CCCCAGGTTCAGCCAGAGCAGGG - Intergenic
1121699583 14:95942456-95942478 TTCCAGCTGCATTCACAGGATGG - Intergenic
1121838242 14:97110846-97110868 CTCCAGCTTTATTCAGAAATAGG - Intergenic
1126963916 15:54029797-54029819 CTGCAGCTGAAATCAGAGCAAGG - Intronic
1129312466 15:74722302-74722324 CTACAGCTTCATGCAGAAGATGG - Exonic
1130848253 15:87767649-87767671 TTCCATCTGCATTCAGAGCTTGG - Intergenic
1136417911 16:30114560-30114582 CTCCAGCTTCAGGCAGGCCAAGG - Exonic
1137825247 16:51489368-51489390 CCCCAGGTTCAGCCAGAGCAGGG - Intergenic
1138179517 16:54932361-54932383 CTCCAGCTTCCTACGGGGCAAGG - Intronic
1140296431 16:73713499-73713521 CGCCAGCTTCATGCATTGCATGG - Intergenic
1140540934 16:75755839-75755861 CTCTGGCTTCCTTCAGGGCAGGG - Intronic
1141072990 16:80975048-80975070 TTCCAGCTGCAGTCACAGCAGGG - Exonic
1141831589 16:86512320-86512342 CTCCAGCTTTTTCCAGAGCTGGG - Intronic
1146805814 17:35864361-35864383 CTCCAGCTGTATCCAGAGAATGG - Intronic
1147622767 17:41878840-41878862 CTCCTGCTTCCTTCAAAGCCTGG + Exonic
1148518425 17:48244537-48244559 CTCAAGCTTCACTCACAGCTGGG + Intronic
1148732080 17:49843440-49843462 CCCCAGAGTCATCCAGAGCATGG + Intronic
1148821771 17:50364127-50364149 GAACAGCTTCATTCAGAGCAGGG - Intergenic
1152223005 17:79079483-79079505 CCCCAGGTTCATTCAGGGCTCGG + Exonic
1152482374 17:80563248-80563270 CTCCAGCCTGTTGCAGAGCAAGG - Intronic
1155700592 18:28738236-28738258 CACCAGTTGGATTCAGAGCATGG + Intergenic
1156312509 18:35937718-35937740 TTGCAGCTCCAGTCAGAGCAGGG - Intergenic
1157165842 18:45357668-45357690 CTGCAGCTTCAGGCAGAGGAGGG + Intronic
1157684710 18:49632793-49632815 CTCCAGCTTCTTTGAAAGCGAGG + Intergenic
1158556216 18:58476886-58476908 GACAAGCTTCATTAAGAGCAGGG - Intergenic
1159610076 18:70514890-70514912 CTACATTATCATTCAGAGCAAGG + Intergenic
1159658567 18:71063072-71063094 CTCAAGTTTCATTTAGAGCCTGG + Intergenic
1160429479 18:78801617-78801639 CAGCAGCTTCACCCAGAGCATGG + Intergenic
1161360575 19:3847126-3847148 GGCCAGCTTCCTCCAGAGCAAGG + Intronic
1162932140 19:13962589-13962611 CTCCAGCCTCAGCCAGGGCAGGG - Exonic
1165091593 19:33390903-33390925 CTCTGGCTTCATTCAGACCTGGG - Intronic
1165532907 19:36418738-36418760 CTCCGGGTTCACGCAGAGCAGGG - Intergenic
1168232465 19:55041942-55041964 CTCTATCTTCATTCATATCAAGG - Intronic
926369045 2:12162086-12162108 TTCCAGCTTCATCCACAGCTGGG - Intergenic
929963229 2:46512174-46512196 CTCCAGCTGCATTCACAGCCAGG + Exonic
930583939 2:53247664-53247686 CTTCAGCTTTTCTCAGAGCATGG - Intergenic
931928127 2:67097642-67097664 AAGCAGCTTCCTTCAGAGCAAGG + Intergenic
932557271 2:72835631-72835653 TCCAAGCTTCATTCAGAGCTTGG + Intergenic
934726751 2:96626051-96626073 ATTCAGGTTCAGTCAGAGCAGGG - Intronic
935336670 2:102023015-102023037 CTCCAGCCTGACTCTGAGCATGG - Intronic
935529609 2:104216343-104216365 CTCCAGTTTTCTACAGAGCAAGG - Intergenic
935547738 2:104418638-104418660 CTCCAACTACATTAAGAGTATGG - Intergenic
937263148 2:120599135-120599157 CTCCAGCCTCCTTGACAGCAAGG + Intergenic
940019701 2:149144180-149144202 CTTCAGCTTAATGCAGAGGATGG + Intronic
940134271 2:150418186-150418208 CTCCATCTTGAATCAGAGCTGGG - Intergenic
943200664 2:184819562-184819584 CTCCAGCTTCACTCTGATCTTGG - Intronic
943653348 2:190480965-190480987 CTTCAGCTTAATTCATAGCCAGG - Intronic
945327777 2:208502462-208502484 CTGCAGTATCATGCAGAGCATGG + Intronic
945436178 2:209820541-209820563 CTCCAGCTCCACTAACAGCAGGG - Exonic
945898625 2:215513831-215513853 CTCCAGCTTCATTCACTGAGTGG - Intergenic
948119882 2:235522203-235522225 CTCCAGCTTCTAACAGAGCCTGG - Intronic
948281940 2:236753498-236753520 ATCCTGCTTCAGTCTGAGCATGG - Intergenic
1168936460 20:1670077-1670099 CTCCATCCTCATTGAGAACATGG - Intergenic
1169527431 20:6445251-6445273 CTCCACCTCCTTTCAGATCAGGG + Intergenic
1175688870 20:61051297-61051319 CTCCAGCTCCAAGCAGAGCAGGG + Intergenic
1176927996 21:14773878-14773900 CTCCAGCTTCATTGAAAACCGGG + Intergenic
1180178918 21:46109307-46109329 CCCCAGGCTCAGTCAGAGCAGGG - Intronic
1181732730 22:24859407-24859429 CCCCAGGTTCCTTCAGAGCCAGG - Intronic
1181972181 22:26699210-26699232 CTCCCCAGTCATTCAGAGCATGG - Intergenic
1182561784 22:31165556-31165578 ATCCAACTACATTCAGATCAGGG - Intronic
1183283393 22:36946513-36946535 CCAAAGCTTCATCCAGAGCAAGG - Intergenic
1183923970 22:41192437-41192459 CTCTCGCTTGATTAAGAGCACGG + Intergenic
1185006060 22:48277660-48277682 CTCCAGGTTCCTCCAGGGCAAGG + Intergenic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950267004 3:11581508-11581530 ACCCAGCTTCATTCGGAACAAGG + Intronic
951429656 3:22591662-22591684 ATTCATCTTCATTCAGATCAAGG + Intergenic
952337789 3:32420234-32420256 CTCCAGATGCATCCAGATCAGGG + Intronic
953489862 3:43340440-43340462 CAACAGCATCATTCAGCGCATGG + Exonic
953704405 3:45220299-45220321 CTCCAGATTCATTAACATCAGGG - Intergenic
954886551 3:53880478-53880500 TAGGAGCTTCATTCAGAGCAAGG - Intronic
959837539 3:110937975-110937997 CTCCAGCATATTTCAGAGGAAGG - Intergenic
960811526 3:121631705-121631727 CTCCTGCTTCATTAAGGGCTTGG - Exonic
960908459 3:122624689-122624711 CCCCAGCATCACTCAGTGCAAGG - Intronic
961000931 3:123373540-123373562 CCCCAGCGTCCTTCAGGGCAAGG - Intronic
962317858 3:134369959-134369981 CTCTGGCTACATGCAGAGCATGG - Intronic
962738053 3:138343462-138343484 CTCCAGCTTCATTAGGAGCTAGG - Intergenic
963596347 3:147330908-147330930 AACCAGCTACATTCACAGCAGGG + Intergenic
969351013 4:6597946-6597968 CTTCAGGGTCCTTCAGAGCAGGG + Intronic
969872116 4:10111163-10111185 CTCCAGTGGCCTTCAGAGCAGGG + Intronic
974366885 4:60961748-60961770 TTCCATCCTCATTCAGATCATGG - Intergenic
974656230 4:64826118-64826140 CTGAAGCTTAATCCAGAGCAAGG - Intergenic
975043511 4:69773545-69773567 CTCCAGCTTAAATAAGAGCTAGG + Intronic
976350987 4:84059758-84059780 CTGAAGCTTCAATCAGATCATGG + Intergenic
977055199 4:92182730-92182752 CTCCAGGTTCATCATGAGCATGG + Intergenic
977539225 4:98295601-98295623 CTCTGGCTTCTTCCAGAGCAAGG - Intronic
978045843 4:104126154-104126176 CTACAGTTTCATTTAGAGCAGGG - Intergenic
978577150 4:110198853-110198875 CTGAAACTTCATTCAAAGCAAGG - Intronic
979885885 4:126026844-126026866 CTTCAGCTACCTTCAGAGAAGGG + Intergenic
980750055 4:137076929-137076951 CCCCAGGTTCATGCAGAGCAGGG - Intergenic
983319495 4:166177887-166177909 CTCCAGCTTGCTTATGAGCAAGG + Intergenic
984998796 4:185464406-185464428 CTCCACCTTCAGTCAGAGGGCGG + Intronic
985785062 5:1889014-1889036 CTCCAGCTTGCTTCAAAGCGTGG + Intergenic
990644250 5:57826018-57826040 CTCTAGCTTCATTCATAGCTTGG + Intergenic
990874622 5:60470194-60470216 CCACAGCTTAATCCAGAGCAAGG + Intronic
991559350 5:67933079-67933101 TGCCAGCTTCACTCTGAGCAGGG - Intergenic
992744298 5:79804150-79804172 CTCCAACTTCACTCAGTTCAGGG - Intergenic
993267052 5:85739894-85739916 CTGCAGCTGCATTCAGAGGCTGG + Intergenic
994874528 5:105400910-105400932 TTCCATCTTCACTCAGAACATGG + Intergenic
995382712 5:111552424-111552446 TTCCAGCTTCAGGCAGAGAAGGG + Intergenic
996395333 5:123007874-123007896 TCCCAGCTTAATTCAGGGCAGGG + Exonic
997528556 5:134568664-134568686 CACCAGCTTCAATGAGGGCAGGG + Intronic
998094104 5:139387730-139387752 CCCCAGCTTCTTTCAGAGGAGGG + Exonic
999913609 5:156233227-156233249 CTCCAACTTTATCCAGAGAAAGG + Intronic
1001466128 5:171968117-171968139 CTCCACCTTCATTAGGAGAATGG - Intronic
1001540403 5:172533810-172533832 CTCTAGTTTCATTTATAGCATGG - Intergenic
1002060296 5:176621667-176621689 CTCCAGCTCCCTTCAGCCCAGGG - Intronic
1002504551 5:179670148-179670170 CTGCAGCTTCAGTCAGAGCAGGG + Intergenic
1003660714 6:8058538-8058560 ATGCAGCTCCATTCAGAGGACGG + Intronic
1004834725 6:19517391-19517413 CTCCACCTTCTCTCAGATCAGGG + Intergenic
1006339485 6:33438785-33438807 CCTCAGATTCATACAGAGCACGG - Exonic
1007189804 6:40003777-40003799 CTCCATCTTCCTTCTGGGCATGG + Intergenic
1007434590 6:41799888-41799910 TTCTAGCTTCACTCAGAACAAGG + Exonic
1007742491 6:44021460-44021482 TTCCAGCTTCTTTCTGAGGAGGG + Intergenic
1008511000 6:52275627-52275649 CTACAGCTTCATTCAAAATAGGG + Intronic
1009748138 6:67846915-67846937 CCACAGCCTAATTCAGAGCAAGG - Intergenic
1009802838 6:68563804-68563826 TTCCAGCTTAATTTACAGCAAGG + Intergenic
1013163115 6:107565345-107565367 CTGCAGGTTCAGTCAGACCAAGG + Intronic
1017808123 6:157963918-157963940 CTCAATCTTCAACCAGAGCATGG - Intergenic
1019693675 7:2432579-2432601 CTTCAGCTTCCTGCAGAGCCGGG - Exonic
1020978364 7:15036939-15036961 TTACAGCTTCATACAAAGCAAGG + Intergenic
1022808463 7:33846411-33846433 CTCCAAGGTCATGCAGAGCAAGG + Intergenic
1024557714 7:50617720-50617742 CCCCAGCTCCTTTCTGAGCAGGG - Intronic
1024560202 7:50638072-50638094 GTCCAGTTTCATTCAGACAAGGG - Intronic
1024941475 7:54767584-54767606 CTCCAGCAAGATGCAGAGCACGG - Intergenic
1025940201 7:66071214-66071236 CTCCAGCTCCATGGAGAACATGG + Intergenic
1026065357 7:67066893-67066915 ATCCTTCTTTATTCAGAGCAGGG + Intronic
1026877737 7:73889255-73889277 CTGCAGCTCCTTGCAGAGCAGGG - Intergenic
1032079216 7:128850307-128850329 CTCCAGCTTCAGTCATAGCATGG + Intronic
1032794957 7:135269758-135269780 CTCCAGCCTCATCCAGCTCAGGG - Intergenic
1033335229 7:140446646-140446668 CTCCACCTTCAGTCAGACCAGGG - Intergenic
1033561385 7:142535611-142535633 GTCCAGCTTCCTGCAGAGCAGGG - Intergenic
1034534483 7:151718466-151718488 CTCCAGCTGCATGCAGGTCATGG + Intronic
1036101536 8:5792389-5792411 CTCCATCTTAATTAGGAGCAGGG + Intergenic
1036621683 8:10428142-10428164 CCACAGGTTCTTTCAGAGCACGG + Exonic
1037156234 8:15702688-15702710 CTCCAGATGCATTCTGAACAGGG + Intronic
1038611886 8:29066224-29066246 GTCCTGCCTCATTCAGAGCAGGG + Intergenic
1041400968 8:57444929-57444951 CTCCAACTTCCTTCATAGTATGG - Intergenic
1044742920 8:95345726-95345748 CTCTAACTTGGTTCAGAGCATGG + Intergenic
1045805571 8:106157029-106157051 TTCCAGCTTCATTAACAGTAAGG - Intergenic
1045904006 8:107321022-107321044 TTCCATCTTCATTCAGAGAAAGG + Intronic
1046147040 8:110173856-110173878 CTCCAGTTTCATCCATATCATGG - Intergenic
1046368205 8:113265417-113265439 CTCCAGCTTCATTTCTAGCCAGG - Intronic
1046850190 8:118963443-118963465 TTCCAGCTTCATTCAACTCAAGG + Intergenic
1047578550 8:126186212-126186234 CTCCAGCTGTTTTCAGGGCAAGG + Intergenic
1048342281 8:133549457-133549479 CAGAGGCTTCATTCAGAGCAGGG - Intronic
1049432954 8:142573745-142573767 TTTCAGCTTCATGTAGAGCAGGG + Intergenic
1050581085 9:7057886-7057908 CTCTTGCTTCATTTTGAGCACGG + Intronic
1051590024 9:18768333-18768355 CTCCAGCTGCGTCCAGAGCATGG + Intronic
1051602339 9:18887988-18888010 CCCCTGCCTCATTCTGAGCAAGG - Exonic
1053032521 9:34793458-34793480 TTTCAGCTTCATTCAGTGGAAGG - Intergenic
1055293675 9:74812245-74812267 CTCCAGATTCAAGAAGAGCAAGG - Intronic
1059079391 9:111232426-111232448 CTCCACCTTCTGTCAGATCAGGG + Intergenic
1059173682 9:112149865-112149887 CTGCAGCCTCATCCGGAGCAGGG + Intronic
1187200729 X:17131431-17131453 CTCTAACCTCCTTCAGAGCATGG - Intronic
1187761500 X:22591403-22591425 CTCCAGATACATTCAAAGGAGGG - Intergenic
1188729091 X:33624078-33624100 CTCCAGACTCATTCAGATAAGGG - Intergenic
1194364739 X:93001071-93001093 CTAAAGCCTAATTCAGAGCAAGG + Intergenic
1195652071 X:107295452-107295474 CTCCTGCTTCATTCCCACCATGG - Intergenic
1196378321 X:115060346-115060368 CTAAAGCTTAATGCAGAGCAAGG + Intergenic
1198759769 X:140019102-140019124 CTCCTGCTCCTTGCAGAGCAGGG + Intergenic
1198779016 X:140214948-140214970 CTCCTGCTCCTTGCAGAGCAGGG - Intergenic
1198871731 X:141183020-141183042 CTTCAGGTTAATTTAGAGCAGGG - Intergenic
1200672967 Y:6117332-6117354 CTAAAGCCTAATTCAGAGCAAGG + Intergenic