ID: 1090344191

View in Genome Browser
Species Human (GRCh38)
Location 11:126054779-126054801
Sequence GTTCAGCAGAGTGCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090344190_1090344191 3 Left 1090344190 11:126054753-126054775 CCAGGATATCTGAGTGTTTAGTA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1090344191 11:126054779-126054801 GTTCAGCAGAGTGCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 211
1090344189_1090344191 7 Left 1090344189 11:126054749-126054771 CCATCCAGGATATCTGAGTGTTT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1090344191 11:126054779-126054801 GTTCAGCAGAGTGCAAAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090344191 Original CRISPR GTTCAGCAGAGTGCAAAGAA AGG Intronic
900688399 1:3964246-3964268 GCTCATCACAGTGCAATGAACGG + Intergenic
902349925 1:15847188-15847210 GTTCAGCAGAGCGGTGAGAAGGG + Intergenic
904448527 1:30595834-30595856 CAGCAGCTGAGTGCAAAGAAGGG - Intergenic
905463460 1:38136107-38136129 GATCAGCACATTGCAAAGACAGG + Intergenic
905487128 1:38309398-38309420 GTTCAACAGAATGCAAGAAAAGG - Intergenic
910740958 1:90515784-90515806 GTACAGAAGAATACAAAGAATGG + Intergenic
910789035 1:91031537-91031559 GTTTTGCAGAGTGCAAAGCAGGG - Intergenic
911513854 1:98842989-98843011 GTTCAGCAGGGTTCAAAAGAAGG + Intergenic
912949437 1:114110638-114110660 CTTCAGCAGCTTGTAAAGAATGG + Intronic
913145378 1:115984379-115984401 GTTCATGAGAGCACAAAGAATGG - Intronic
916247302 1:162701545-162701567 GTTCACCAGAGTGCAAAAGCAGG - Intronic
916937154 1:169641054-169641076 GTTCAGAAAAGCACAAAGAAGGG + Intergenic
921948329 1:220904344-220904366 GGTCAGAAAAGAGCAAAGAATGG + Intergenic
922826885 1:228527744-228527766 GTTCAACAGAAAGCAAAGACTGG + Intergenic
923281515 1:232447454-232447476 GTGCTGCACAGTGCAAAGGATGG + Intronic
923457386 1:234176194-234176216 GTGCAGCAGAGTGTGGAGAATGG - Intronic
923526661 1:234778179-234778201 CTTCAGCAGAGGGCAAAGGGTGG + Intergenic
923795979 1:237155990-237156012 GTTCAGCAGAGGGAACAGCAGGG - Intronic
923823117 1:237469153-237469175 GATCAGCAGATTGGAAAGACTGG + Exonic
924918579 1:248601397-248601419 ATTTAGAAGAGTACAAAGAATGG + Intergenic
1065286807 10:24194492-24194514 GTTCAGCAGAGTGAAAATAAAGG - Intronic
1066337638 10:34495351-34495373 GTTCATCAGAGTCCAAATAAAGG + Intronic
1067527490 10:47047317-47047339 GTGCAGGAGAGTGCAGAGATAGG + Intergenic
1067936068 10:50613209-50613231 TGTCAGCAGAGTGCACAGAAGGG - Intronic
1068469174 10:57438373-57438395 GTCCTGCAGAGTGAAATGAAAGG + Intergenic
1070433445 10:76364184-76364206 GCCTAGGAGAGTGCAAAGAAGGG + Intronic
1072334882 10:94389117-94389139 ATTCAGCAGAGTGCCAGTAAAGG - Intergenic
1072493108 10:95928168-95928190 CTGGAGCAGAATGCAAAGAAAGG - Intronic
1073997099 10:109328131-109328153 GTACAACACAGTGCAAAGAATGG - Intergenic
1074048743 10:109863539-109863561 GTTCTGCAAAGTACAATGAAAGG + Intergenic
1074159260 10:110823556-110823578 GTTCCCAAGAGGGCAAAGAAAGG - Exonic
1075584011 10:123644283-123644305 GTTCTCCAGAGCACAAAGAAGGG + Intergenic
1075930355 10:126289809-126289831 GTCCAGCAGAGTTAAAAGATTGG - Intronic
1076876672 10:133219670-133219692 GTCCAGCAGAGAGCAAGGAAAGG + Intronic
1077634844 11:3835396-3835418 GTTCAGCACAATGAAAAGTACGG - Intronic
1078911382 11:15735890-15735912 GTTCAACAGAGTGAAATGAATGG - Intergenic
1080682080 11:34486518-34486540 GGGCAGCAGAGTGAATAGAAGGG + Intronic
1081726162 11:45330908-45330930 GTTCAGCAGAGGGAAAACACAGG - Intergenic
1082302333 11:50523437-50523459 GTTCAGCAGTTTGCAAACATTGG + Intergenic
1082594929 11:55066077-55066099 ATTCAGCAGTGTGCAAACACTGG - Intergenic
1083097438 11:60266193-60266215 GTTCACCAGAGTGCAGAGAATGG - Intergenic
1084848013 11:71916077-71916099 GTTCAGCACAGAGCTCAGAAGGG + Exonic
1085439861 11:76550116-76550138 GTTCAGCAGAGCTCTGAGAAGGG - Exonic
1089108351 11:116034292-116034314 GGTCAGCAGAGGGCAGAGCAAGG + Intergenic
1089310142 11:117552492-117552514 GCTCAGCTGAGTGCCAAAAAGGG - Intronic
1089760085 11:120716823-120716845 GCTCATCAGAGTGCTAAGGATGG + Intronic
1090344191 11:126054779-126054801 GTTCAGCAGAGTGCAAAGAAAGG + Intronic
1091714637 12:2768163-2768185 GTTCAGCAGGTGGAAAAGAATGG - Intergenic
1093489000 12:19683553-19683575 CTTCATCAGAGGGCAAACAATGG - Intronic
1093777099 12:23088599-23088621 ATTCAGCAAAGTGCAAACAATGG - Intergenic
1094789895 12:33900323-33900345 CATCAGCTGAGAGCAAAGAAAGG - Intergenic
1095971925 12:47908002-47908024 ATTCCACAGAGTCCAAAGAAAGG + Intronic
1097718009 12:62987671-62987693 GTTGACCAGAGTTGAAAGAATGG + Intergenic
1098618497 12:72560426-72560448 ATTCAGCAAAGTGGAAATAAAGG - Intronic
1103343687 12:120235271-120235293 GCCCAGCAGAGTGCCAAAAAGGG + Intronic
1105247040 13:18662708-18662730 GTACTGCAGAGTGCACAGATAGG - Intergenic
1106927178 13:34625077-34625099 GCTCAGTAGAGTGAAAAGAATGG + Intergenic
1108416648 13:50204325-50204347 ATTAAGCAGACTGCAGAGAAAGG + Intronic
1110025571 13:70534428-70534450 GTTCAGCACAGTTCACTGAAAGG + Intergenic
1112646171 13:101334496-101334518 GTTCAGAAGAGTACAGAGTACGG + Intronic
1114126675 14:19735328-19735350 GTTAAGCAGAGAGTAATGAAGGG - Intronic
1114323872 14:21569866-21569888 GTTCCGCAGAGTGTAGATAAGGG + Exonic
1115721568 14:36167312-36167334 TTTCACCAGTGTGCAGAGAAAGG - Intergenic
1115756014 14:36526295-36526317 TTTGACCAGAGTCCAAAGAAGGG - Intergenic
1116059954 14:39910361-39910383 GTGCACCAGAGTTCAGAGAAGGG - Intergenic
1118713382 14:68540791-68540813 TTTCAACAAAGAGCAAAGAATGG + Intronic
1118899239 14:69972856-69972878 GTTAAGCAGGCTGCAGAGAACGG - Intronic
1119849950 14:77860145-77860167 GTTCTGCAGAGCCCAAAGGAGGG - Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1123414382 15:20084276-20084298 GCTTAGCAGAGTGCCAAGGAGGG - Intergenic
1123471612 15:20558735-20558757 GTTCTGCAGAGTGAAAAGATTGG - Intergenic
1123523724 15:21091387-21091409 GCTTAGCAGAGTGCCAAGGAGGG - Intergenic
1123646391 15:22441620-22441642 GTTCTGCAGAGTGAAAAGATTGG + Intergenic
1123731917 15:23153733-23153755 GTTCTGCAGAGTGAAAAGATTGG - Intergenic
1123750053 15:23351115-23351137 GTTCTGCAGAGTGAAAAGATTGG - Intergenic
1124282419 15:28375012-28375034 GTTCTGCAGAGTGAAAAGATTGG - Intergenic
1124300283 15:28536585-28536607 GTTCTGCAGAGTGAAAAGATTGG + Intergenic
1127565719 15:60186288-60186310 CTTCAGCAGAGTACAAGGATAGG + Intergenic
1129533528 15:76290842-76290864 GTACAGCAGTGTGCAGAGCAAGG - Intronic
1130628370 15:85539430-85539452 GTCCAGAATAGTACAAAGAATGG + Intronic
1131671486 15:94624486-94624508 GTTCAGGAGAGAGAAAGGAAAGG + Intergenic
1131725037 15:95212511-95212533 TTTCAACAATGTGCAAAGAATGG + Intergenic
1132289947 15:100692984-100693006 CTTCAGCATAGTGAAAAGATAGG + Intergenic
1134596815 16:15502355-15502377 GGACGGCGGAGTGCAAAGAAAGG + Intronic
1139013116 16:62657643-62657665 ATGCAACAGAGTGGAAAGAAAGG - Intergenic
1139397383 16:66651125-66651147 GGGCAGCAGAGAGCAAAGCAGGG + Intronic
1141040527 16:80669264-80669286 ATCCAGCAAAGTGCCAAGAAGGG + Intronic
1143282087 17:5762500-5762522 TTTCAGCAGAGTGTAAAAATTGG + Intergenic
1143637939 17:8177015-8177037 GATTTGCAGAGTGCAAAAAATGG + Intergenic
1144423158 17:15116218-15116240 GTTCATGAGTATGCAAAGAAAGG - Intergenic
1146574555 17:33979659-33979681 GCTCTGCAGAATGCTAAGAAGGG - Intronic
1149494057 17:57105974-57105996 CTTCAGCAGGGTGCCAAGGAAGG + Exonic
1149686911 17:58541107-58541129 GGTCAGCAAAGAGCAGAGAAGGG - Intergenic
1153682360 18:7512630-7512652 TCTTAGCAGAGTGGAAAGAAAGG - Intergenic
1154366932 18:13719551-13719573 GTGCAGCAGTGGGCAAAGAATGG - Intronic
1154441804 18:14396413-14396435 GTACTGCAGAGTGCACAGATAGG + Intergenic
1156083287 18:33366749-33366771 GTTAGGCAGAGGGCAAAGCAAGG - Intronic
1156821653 18:41380160-41380182 GTTTAGCAGTATGCAAAGGAGGG + Intergenic
1157996288 18:52560380-52560402 GTACAGCAGTGAGCTAAGAATGG - Intronic
1158885250 18:61820795-61820817 GCTCAGCAGAGTGGGAAGACTGG + Intronic
1159567163 18:70064663-70064685 ATTCCGTAGAGTGCCAAGAATGG + Intronic
1160140686 18:76319269-76319291 CTTCAGCAAAGTGCAAGGATAGG + Intergenic
1160401297 18:78613230-78613252 GGACAACAGAGAGCAAAGAAAGG + Intergenic
1162688351 19:12407142-12407164 GTTCATCAGAGTGAAGAAAAAGG + Intronic
1165536848 19:36455317-36455339 GTTGAGCAGAGTGTCAAGAGTGG - Intronic
1166943846 19:46385132-46385154 TTTCAGCAGATGGCAAACAAGGG + Intronic
928430278 2:31212626-31212648 TTTCACCAGAGTGCAAAAATAGG + Intronic
928453675 2:31400540-31400562 GTTAGGCTGAGTGGAAAGAAAGG - Intronic
928588957 2:32793403-32793425 GTCCTGCAGGGTGAAAAGAAAGG + Intronic
929665049 2:43827420-43827442 GTCTACCACAGTGCAAAGAAAGG + Intronic
930362306 2:50397079-50397101 ACTCAGCAGAGTGCACAGTAGGG - Intronic
931464037 2:62471480-62471502 GTTCAAAGGAGTTCAAAGAACGG + Intergenic
932529939 2:72518824-72518846 GTACTGCAGAGAGTAAAGAAAGG + Intronic
933153576 2:78945437-78945459 GTTCATCAGAAAGCAAATAAAGG + Intergenic
935516474 2:104046778-104046800 TTTCAACAGAGTTCAAAGCAGGG - Intergenic
937657896 2:124398052-124398074 GTAAATCACAGTGCAAAGAAAGG - Intronic
944627300 2:201584425-201584447 GTTAACCAGAGTCCAAGGAAAGG + Intronic
945221661 2:207489996-207490018 GGTCAGCAGAGTGGCATGAAAGG + Intergenic
945719142 2:213396936-213396958 ATTCAATAGAGTACAAAGAAAGG - Intronic
946312607 2:218891337-218891359 GCTGAGCAGAGTCAAAAGAAGGG - Intronic
947647441 2:231753959-231753981 GCTCACCAGAGTGCATAGAGGGG - Intronic
948149054 2:235730297-235730319 GGACAGCAGAGTGCCAAGCAGGG - Intronic
1169405216 20:5316508-5316530 GAGCAGCAGAGCGCACAGAAAGG - Intergenic
1170121217 20:12914508-12914530 ATTCAGCAGATTGTAGAGAAAGG + Intergenic
1170786266 20:19470200-19470222 GTACAGCAGATGGAAAAGAAAGG - Intronic
1172771853 20:37386672-37386694 GTGCAGGAGAGTGCAATGGAAGG - Intronic
1173114110 20:40223713-40223735 GTGCAGCAGTCTGCAAAGCAGGG + Intergenic
1173177796 20:40777581-40777603 GCTCAGCAAAATGCAAAGAAAGG - Intergenic
1173734529 20:45349760-45349782 GTTCAGCCCACTGCTAAGAATGG - Intergenic
1175426466 20:58870465-58870487 GGTCAGCAGAGAGCTCAGAATGG + Intronic
1175649908 20:60711193-60711215 GCCCAGCAGAGTTCAAAGAAAGG - Intergenic
1176454264 21:6894764-6894786 GTACTGCAGAGTGCACAGATAGG - Intergenic
1176832438 21:13759812-13759834 GTACTGCAGAGTGCACAGATAGG - Intergenic
1177868600 21:26543456-26543478 GTGCAGCAGGGCTCAAAGAATGG + Intronic
1178821645 21:35980998-35981020 CATCAGCTGAGAGCAAAGAAGGG - Intronic
1179477081 21:41653853-41653875 TTTGAGCAGAGCTCAAAGAAAGG - Intergenic
1179768778 21:43597031-43597053 GGTCACCAGGGTGGAAAGAAAGG + Intronic
1180073551 21:45450495-45450517 GTTCATCAGGGGGCAAAGAGGGG - Intronic
1182540382 22:31037275-31037297 TTTCAGCTCAGTGCAATGAAGGG - Intergenic
1182545731 22:31075291-31075313 GCTTAGCAGAGTGCCAAGGAGGG + Intronic
1182873145 22:33666215-33666237 GTTCAGCAGACTGTTAAAAATGG - Intronic
1184346683 22:43917914-43917936 GTTCACCAGAGTGGAGAGATGGG - Intergenic
1185177746 22:49339415-49339437 ATCCAGCAGGGTGCACAGAAGGG - Intergenic
949535659 3:4994610-4994632 ATTCAGCAGTGTGCACAGAGTGG - Intergenic
949787217 3:7755112-7755134 TTTAAACAGAGGGCAAAGAAAGG + Intergenic
950501211 3:13365094-13365116 GCTAGGCAGAGTTCAAAGAAAGG + Intronic
951336459 3:21428601-21428623 GCTGAGCAGAGTGCCACGAATGG + Intronic
951477957 3:23128759-23128781 ATTCAACAGAGTGAAGAGAAAGG - Intergenic
951791130 3:26485930-26485952 GTTCAACAGGTTGCAGAGAATGG - Intergenic
952075262 3:29688365-29688387 GTTTAGAAGAGGGCAAAGACAGG + Intronic
952138249 3:30448315-30448337 CTTCAGCAGAGTGCACATAATGG + Intergenic
953412797 3:42699697-42699719 GAACAGCAGAGAGCAGAGAAGGG + Intronic
953713884 3:45299052-45299074 GTTCAAGAAAGTGCACAGAATGG - Intergenic
954173044 3:48820756-48820778 GTTCAGCAGAGAAACAAGAAGGG + Intronic
954336333 3:49920263-49920285 GGTCAGAAGAGAGCCAAGAAAGG - Intronic
956622581 3:71236087-71236109 GGTCAGCAGAGAGGAGAGAATGG - Intronic
958472401 3:94537319-94537341 ATTCATCAGAATGAAAAGAAAGG - Intergenic
962795962 3:138850000-138850022 TTTCAGCATAGGGGAAAGAAAGG - Intergenic
964056748 3:152470419-152470441 GTTCAGCAGATGGTAAGGAAAGG - Intergenic
965387780 3:168065327-168065349 GTTTAGCACAATGCTAAGAAAGG + Intronic
966053410 3:175650876-175650898 GATTTGCTGAGTGCAAAGAATGG - Intronic
967078251 3:186024792-186024814 TTTCATCCGAGTGAAAAGAATGG + Intergenic
968003914 3:195226414-195226436 GTTGAGCAGTGGGGAAAGAAGGG + Intronic
969536924 4:7761977-7761999 GTGCATCAGAGGGGAAAGAAAGG + Exonic
973643422 4:52926013-52926035 CTTCAGCAGAGTGAGAGGAATGG + Intronic
974496754 4:62639414-62639436 GTTCAGCAGATTGAAATGAAAGG + Intergenic
978714762 4:111828109-111828131 GTTCACCAGAATACAAAGGAAGG - Intergenic
978756948 4:112313006-112313028 TGTCAGCAGAGTGAAATGAAAGG - Intronic
979022167 4:115516556-115516578 GATCTGCAGTGTGCAATGAAAGG + Intergenic
979721957 4:123910873-123910895 GGTCAGTAAAGTGAAAAGAAAGG + Intergenic
980174753 4:129330933-129330955 TTTCAGTAGAATGGAAAGAATGG + Intergenic
982150296 4:152446908-152446930 GTTCATCAGTGTTCACAGAAGGG + Intronic
982546463 4:156739018-156739040 GTTCAGCAGTGTGCATGGCAGGG + Intergenic
984023270 4:174512079-174512101 GATCAGCAAAGTGAAAAGTAAGG + Intronic
984807520 4:183765392-183765414 CTTCAGCACATTTCAAAGAATGG - Intergenic
985218772 4:187680834-187680856 TTCCAGCATAGTACAAAGAAGGG - Intergenic
987360689 5:17103875-17103897 CTGCAGCAGAATCCAAAGAAGGG + Intronic
987717247 5:21587526-21587548 GTTAAGGAAAGAGCAAAGAAAGG + Intergenic
989356802 5:40552554-40552576 GTTCACCAGAGAGCAAAGTAGGG + Intergenic
990481120 5:56211715-56211737 GTGCAACAGGGTGGAAAGAAGGG - Intronic
990944055 5:61231408-61231430 GTGCTGCGGAGTGTAAAGAAAGG - Intergenic
992113732 5:73519869-73519891 GGGCAGCAGAGAGCAATGAATGG + Intergenic
993781800 5:92075602-92075624 GTTCAACAGAGTGCAGAAGAAGG - Intergenic
996315427 5:122155355-122155377 ATTCAGTAGAGGGCATAGAAGGG + Intronic
996449920 5:123609320-123609342 GTTCAGCAGATTGCAGAAAATGG + Intronic
998536753 5:142939987-142940009 GTTCACCAGAGTGCAGGGCAGGG + Intronic
998590099 5:143468970-143468992 TTTCGGCAGAGTAGAAAGAATGG + Intergenic
998873283 5:146574421-146574443 GTTCAGGAGTGTGCAAATGATGG + Intergenic
999006094 5:147981166-147981188 TTACAACAGAGTGCAAGGAAGGG - Intergenic
999180102 5:149663993-149664015 GTACAGCAGGGAGCTAAGAATGG + Intergenic
1002088423 5:176790503-176790525 GTACAGAAGAGAGCAAAGACAGG + Intergenic
1003669352 6:8141700-8141722 GATAAGCAAAGTGCAAAGACAGG + Intergenic
1004582135 6:16964689-16964711 GTCCAGCAATGTGCCAAGAAAGG - Intergenic
1004773206 6:18810494-18810516 ATTCAGGAGGGTGGAAAGAAGGG + Intergenic
1006555180 6:34859681-34859703 GTCCAGGAGAATGCATAGAATGG + Intronic
1008588145 6:52967572-52967594 GAACAGCTGAGTGCAGAGAAGGG + Intergenic
1008652942 6:53581626-53581648 TTTCAGCAGAGTGCAATAAAAGG + Intronic
1009297778 6:61975499-61975521 CATCAGCAGAAAGCAAAGAATGG - Intronic
1009502086 6:64426566-64426588 GTTCAGCAGAGAGAAAAAGATGG + Intronic
1010553406 6:77251112-77251134 GTTAAGCAGTATGCAAAGCAAGG - Intergenic
1012001920 6:93664607-93664629 GTTCTGCAGGCTGTAAAGAAAGG + Intergenic
1015158391 6:130124300-130124322 GTTCTGAAGGGCGCAAAGAATGG + Intronic
1019430194 7:995540-995562 GACCCGCAAAGTGCAAAGAAGGG - Intergenic
1020866836 7:13574927-13574949 ATTCTGAAAAGTGCAAAGAAGGG + Intergenic
1025640458 7:63362413-63362435 CGTCAGCAGATCGCAAAGAAAGG + Intergenic
1025642241 7:63385680-63385702 CGTCAGCAGATCGCAAAGAAAGG - Intergenic
1026976109 7:74499374-74499396 GTTCAAAAGTGTGCAAGGAAGGG + Intronic
1027862965 7:83608246-83608268 ATTCAACAGAATGAAAAGAAAGG + Intronic
1029164288 7:98575896-98575918 TTTCAGCAGAGGTGAAAGAAAGG - Intergenic
1029978352 7:104854954-104854976 GTTCACAAAAGTGCAGAGAAAGG - Intronic
1030219451 7:107081765-107081787 TTTCAGAATAGTGGAAAGAAGGG + Intronic
1031151778 7:118061992-118062014 TTACAGCAGAGTCAAAAGAAGGG + Intergenic
1032910881 7:136428246-136428268 GTTGAGCAGTATGCAAACAAAGG - Intergenic
1035015811 7:155764760-155764782 GTTCTCCAGAGCGCAAAGCAGGG - Intronic
1035392017 7:158510558-158510580 GTTCAAAAGGATGCAAAGAAGGG - Intronic
1036676049 8:10834080-10834102 CTGCAGCAAAGTGCAAAAAAGGG + Intronic
1037775813 8:21834923-21834945 GATCAGCAGGGAGGAAAGAAAGG + Intergenic
1039023419 8:33231762-33231784 GTTCTGCAGAAGACAAAGAAGGG - Intergenic
1041627117 8:60042977-60042999 CTTCAGCAAAGTGAAAAGGAAGG - Intergenic
1043739197 8:83788111-83788133 GTTCATAAGAGTCCAAAGACAGG - Intergenic
1043999173 8:86857333-86857355 GTTCAGCATAGTTCAAGCAAAGG - Intergenic
1044257485 8:90082545-90082567 GCTCAGAAAAGGGCAAAGAATGG + Intronic
1045693918 8:104786753-104786775 TTTGAGCAGAGTGGAAACAAAGG - Intronic
1047142809 8:122161001-122161023 GGGCAGCAGAGTTCAGAGAAGGG - Intergenic
1048198263 8:132350613-132350635 GTGCACCACAGAGCAAAGAAGGG + Intronic
1055256470 9:74377329-74377351 GTTCAGCACATTACAAACAAAGG - Intergenic
1055927885 9:81529429-81529451 TTTCAGCAGAGTTCAAACCAGGG - Intergenic
1056781549 9:89554766-89554788 CTTCAGAAGAGTGGAAAGAAGGG + Intergenic
1056850968 9:90083550-90083572 GTGCACCAGAGTGCAAGGCAAGG + Intergenic
1057517656 9:95735670-95735692 GTTCACCAGAAAGAAAAGAAGGG - Intergenic
1057990104 9:99759745-99759767 TTTCAGCAGAGGTCCAAGAAAGG - Intergenic
1058921129 9:109616131-109616153 GTTCAGGAGAGTTCCAAGCATGG - Intergenic
1059545307 9:115169770-115169792 GTTCATCAGTGTGTAAATAACGG - Intronic
1187770653 X:22692147-22692169 GTTCAGCTGTCAGCAAAGAAAGG + Intergenic
1187786720 X:22896897-22896919 GTTCAGCAGTGAAAAAAGAATGG - Intergenic
1198207407 X:134480243-134480265 GTTCTGCAGAGTTAAAAGATTGG - Intronic
1201140573 Y:11024923-11024945 GTGCAGCGGATTGGAAAGAATGG - Intergenic