ID: 1090344808

View in Genome Browser
Species Human (GRCh38)
Location 11:126061822-126061844
Sequence AATGCCTGCCCTTCCTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090344808_1090344819 29 Left 1090344808 11:126061822-126061844 CCTGATGAGGAAGGGCAGGCATT 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1090344819 11:126061874-126061896 CACCTGATTTGGTGGGGTTAGGG 0: 1
1: 0
2: 0
3: 9
4: 192
1090344808_1090344818 28 Left 1090344808 11:126061822-126061844 CCTGATGAGGAAGGGCAGGCATT 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1090344818 11:126061873-126061895 CCACCTGATTTGGTGGGGTTAGG 0: 1
1: 0
2: 0
3: 16
4: 165
1090344808_1090344814 22 Left 1090344808 11:126061822-126061844 CCTGATGAGGAAGGGCAGGCATT 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1090344814 11:126061867-126061889 AGCCTTCCACCTGATTTGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 91
1090344808_1090344813 21 Left 1090344808 11:126061822-126061844 CCTGATGAGGAAGGGCAGGCATT 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1090344813 11:126061866-126061888 GAGCCTTCCACCTGATTTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 86
1090344808_1090344812 18 Left 1090344808 11:126061822-126061844 CCTGATGAGGAAGGGCAGGCATT 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1090344812 11:126061863-126061885 GGAGAGCCTTCCACCTGATTTGG 0: 1
1: 0
2: 1
3: 8
4: 90
1090344808_1090344810 -3 Left 1090344808 11:126061822-126061844 CCTGATGAGGAAGGGCAGGCATT 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1090344810 11:126061842-126061864 ATTCTGGAAACAGCTCCTTTTGG 0: 1
1: 0
2: 2
3: 23
4: 268
1090344808_1090344815 23 Left 1090344808 11:126061822-126061844 CCTGATGAGGAAGGGCAGGCATT 0: 1
1: 0
2: 3
3: 15
4: 183
Right 1090344815 11:126061868-126061890 GCCTTCCACCTGATTTGGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090344808 Original CRISPR AATGCCTGCCCTTCCTCATC AGG (reversed) Intronic
900121651 1:1050871-1050893 GCTGCCTGCTCTTCCTCCTCGGG + Intronic
900314992 1:2051980-2052002 CATGGCTGCCCTACCTCTTCAGG - Intronic
902254111 1:15176485-15176507 AAGGCCTCTCCTTCCACATCCGG - Intronic
903374814 1:22859223-22859245 AATGCCTTCCCTTCACCATCAGG - Intronic
904349342 1:29894655-29894677 CATGCTTGTCCTTCCCCATCAGG - Intergenic
904368806 1:30035456-30035478 CAGGCCTGCCCTTTCTCAGCAGG - Intergenic
905258134 1:36698612-36698634 GAAGCCTGGCCTTCCTCACCTGG - Intergenic
908110270 1:60889772-60889794 AAGACCTGCCTTTCCTCCTCTGG - Intronic
909480435 1:76124215-76124237 CGTGCCTGCCCTTCCTCTTTGGG + Intronic
912305724 1:108564519-108564541 AATGCCTCCCACTACTCATCAGG - Intronic
912482337 1:109992880-109992902 GAGGCCTGGCCTTCCACATCAGG - Intronic
912696556 1:111846598-111846620 CATGCTTCCCCTTCCTCATAAGG + Intronic
913025462 1:114833545-114833567 TATGCCTTGCCTTCTTCATCTGG - Intergenic
915835657 1:159172953-159172975 ACAGCCTGCCCTCCCTCCTCAGG - Intronic
918169578 1:181983700-181983722 AATGCCTGCCATTGGCCATCAGG + Intergenic
919794906 1:201315740-201315762 AATACCTGCCCTTGGACATCAGG + Intronic
920693229 1:208162745-208162767 AATGCCTTACTTTCTTCATCAGG - Intronic
921340356 1:214128432-214128454 GATGCCTTCCCTCACTCATCTGG - Intergenic
922424803 1:225482781-225482803 AATGCCTGCATTTGCTCATTTGG + Intergenic
922793604 1:228324823-228324845 AATGCCTCAGCCTCCTCATCTGG + Intronic
924428573 1:243976722-243976744 AATGCCTGCCTTTCCTAATTTGG + Intergenic
924569035 1:245221025-245221047 AATGACTGCCTTCCCTCAGCTGG + Intronic
1063846136 10:10128534-10128556 TATCCCTCCCCTTCCTCACCAGG - Intergenic
1064637776 10:17386749-17386771 AACCCCTGCCCGTCCTCATTTGG - Intronic
1068601129 10:58957792-58957814 CATGCCTGATCTTCCTCTTCTGG + Intergenic
1070487974 10:76949031-76949053 CATGCCTGTGCTTCTTCATCTGG - Intronic
1072677241 10:97477051-97477073 ATTGCCTCCCCTTTCTCTTCAGG + Intronic
1074277925 10:112022572-112022594 AATTCCTGACCTTCAGCATCTGG + Intergenic
1075927335 10:126262923-126262945 AATGTCTGAGATTCCTCATCTGG - Intronic
1083280925 11:61626954-61626976 AATCCCAGCCCTTCCCCAGCAGG - Intergenic
1086938044 11:92765998-92766020 ATTTCCTGCCCTTCCTCTTATGG - Intronic
1087141047 11:94766791-94766813 TATGCCTGAGCTTCTTCATCCGG + Intronic
1088902109 11:114126220-114126242 AATGCCAGCTCTGCCCCATCTGG + Intronic
1089995700 11:122905150-122905172 AATGCCTTCTCTTCCTCATCAGG + Intronic
1090032652 11:123220327-123220349 ATTGCCTTCCCTACTTCATCAGG + Intergenic
1090277184 11:125428660-125428682 AATGCCTGCCCTGCCTGCTGGGG + Intronic
1090344808 11:126061822-126061844 AATGCCTGCCCTTCCTCATCAGG - Intronic
1090409125 11:126495552-126495574 TATACCTGGCCTTCCTCCTCCGG + Intronic
1090592868 11:128291101-128291123 ACTGCATGCCCTTCCTGCTCGGG + Intergenic
1092051572 12:5474561-5474583 ATTGTCTGCCCTTCATCGTCTGG - Intronic
1092106203 12:5923350-5923372 AATGCCACCCCTTTCTTATCTGG - Intronic
1093187589 12:16038849-16038871 AATGTCTGCCCATCCTTACCTGG + Intergenic
1096328013 12:50683279-50683301 AATGCCTGCCATGTCACATCAGG - Intronic
1098578856 12:72075205-72075227 TATACCAGGCCTTCCTCATCTGG - Intronic
1099615078 12:84923909-84923931 AATGCCTGCTCTCCCACATGTGG + Intergenic
1102628197 12:114253386-114253408 ACTCCCTACCCTTCTTCATCTGG + Intergenic
1102688506 12:114742404-114742426 AATGCCTGCCCGCCCTAACCAGG - Intergenic
1102955074 12:117053880-117053902 GATGCCTGCTCTGGCTCATCTGG + Intronic
1103081979 12:118031408-118031430 AATGCCTGCCCATCCTCTCCTGG - Exonic
1104378886 12:128289944-128289966 TCTGCCTGCCCATCTTCATCAGG - Intronic
1104529347 12:129554218-129554240 GAGGACTGCCCTTTCTCATCTGG + Intronic
1106605875 13:31228255-31228277 AATCCCTACCCTACCTCATAAGG - Intronic
1114578317 14:23733297-23733319 GCTCCCTGCCCTTCCTCATGTGG - Intergenic
1119474815 14:74920949-74920971 CATGCCTCAGCTTCCTCATCTGG + Intronic
1119483438 14:74973958-74973980 TATGCCTGGCTTTCTTCATCTGG - Intergenic
1120890076 14:89483735-89483757 ACTGCCTGCCCTGGCTCAGCCGG + Intronic
1121544488 14:94753431-94753453 AAAGTCTGCTCTTCCCCATCCGG - Intergenic
1122135036 14:99627914-99627936 CATTCCAGCCCTTCCTCCTCGGG - Intergenic
1122142132 14:99668739-99668761 CGTGCCTGCCCTTCCTCCTGTGG + Intronic
1122559789 14:102604543-102604565 AATGCCTCTGTTTCCTCATCTGG - Intronic
1126067463 15:44837150-44837172 CATGCCTGCCCTTCCACATCTGG + Intergenic
1126092414 15:45063731-45063753 CACGCCTGCCCTTCCACATCTGG - Intronic
1127290777 15:57569148-57569170 AAGGCCTTTTCTTCCTCATCTGG - Intergenic
1127468993 15:59273628-59273650 AATGAATGTCCTTCCTCCTCTGG - Intronic
1127469000 15:59273671-59273693 AATGAATGTCCTTCCTCCTCTGG - Intronic
1131075371 15:89492164-89492186 AGTGCCAGCCCTGCCCCATCAGG - Intronic
1133255773 16:4514754-4514776 AGTTCCTCCCCTTCCACATCCGG + Exonic
1133326940 16:4947603-4947625 AAGGCCTCCCCTTCCTCACCGGG - Intronic
1136346357 16:29678850-29678872 AATGCCTGCCTGCCCTCACCAGG + Intronic
1136383648 16:29909475-29909497 AATACAAGCCCTTCCTCATCTGG - Intronic
1140904495 16:79398836-79398858 AATGCCTGGCCTAGCTCAACTGG - Intergenic
1142354692 16:89596920-89596942 AGTCCCTGCCCCTTCTCATCGGG - Exonic
1142961932 17:3556801-3556823 AGAGGCTGCCCATCCTCATCAGG - Intronic
1143124353 17:4632053-4632075 GATCCCTGCCCTTCCTTAGCTGG - Exonic
1143556902 17:7667742-7667764 ACTGCCTGCCCATGCTCCTCAGG - Intronic
1144682316 17:17204205-17204227 ACTTCCTGCCCTTCCTCAAAAGG + Intronic
1148980148 17:51566664-51566686 AGTTCATGCCCTTCTTCATCTGG - Intergenic
1150632744 17:66891540-66891562 AAGGCCTGGTCTTCCTCATAGGG + Intergenic
1152082135 17:78194541-78194563 AAGGCCTGGCCGCCCTCATCTGG + Intronic
1152350027 17:79778999-79779021 CCTGCCTTCCCTTCCTCCTCTGG + Intronic
1152411263 17:80124508-80124530 TATGCCTGCTCTTCCTGATCTGG + Intergenic
1156533921 18:37844941-37844963 AGTGCCTCAGCTTCCTCATCAGG + Intergenic
1157184268 18:45524756-45524778 AATGCCTCACCTGCCTTATCTGG + Intronic
1157627863 18:49066586-49066608 AATGCCTGCCCTTGCACACGAGG - Intronic
1159926907 18:74277744-74277766 GATGCCTCCCCTTGCTCACCTGG - Intronic
1160034555 18:75288053-75288075 ACTGCCGGCCCTTCCTCTTGTGG - Exonic
1160340196 18:78083012-78083034 GCTGCCTGCCCTTCCCCAGCTGG + Intergenic
1161439623 19:4283280-4283302 CATCCCTGCATTTCCTCATCTGG + Intronic
1161495663 19:4584505-4584527 AATGCCTGCGCGCCCCCATCAGG + Intergenic
1161943914 19:7422553-7422575 AATGACTCACCTTCCTCCTCAGG + Intronic
1163202062 19:15776698-15776720 AAGACCTGCCCTTCCTTATGTGG + Intergenic
1163517293 19:17772738-17772760 AATGGCTGCCCTGACTCACCAGG - Exonic
1164564814 19:29318244-29318266 GATGCCAGCCCTTCCTCAGAAGG + Intergenic
1164824746 19:31277107-31277129 ACTGGCGGCCCTTCCTCTTCTGG + Exonic
1165429666 19:35765300-35765322 CATGCCTGACCCACCTCATCTGG - Intronic
1166976451 19:46607716-46607738 GATGCCTGCATTTCCTCTTCAGG + Intronic
926003542 2:9353665-9353687 CATTCCTCCTCTTCCTCATCTGG + Intronic
931669669 2:64636075-64636097 GACCCCTGCACTTCCTCATCAGG - Exonic
934610161 2:95729584-95729606 TCTGCCTCTCCTTCCTCATCTGG - Intergenic
935784781 2:106538839-106538861 CTTCCTTGCCCTTCCTCATCAGG + Intergenic
936290840 2:111222908-111222930 CATGCCTGCCCTCCCTCCCCTGG - Intergenic
937896628 2:126981075-126981097 AATGCCTGGCCCACCCCATCAGG + Intergenic
941388149 2:164878536-164878558 AATGACTGGCCAGCCTCATCAGG - Intergenic
944396524 2:199273918-199273940 GATGGCTGCAGTTCCTCATCAGG - Intronic
945444794 2:209924241-209924263 AATGTCCCCCTTTCCTCATCAGG + Intronic
945674117 2:212834218-212834240 AATGCCTGGCCTCCCACAGCAGG + Intergenic
946976745 2:225161413-225161435 AATCCCTGCACTTCCTCAGGGGG - Intergenic
947706638 2:232281729-232281751 AATGCCTGCTCTTCCTCCCCTGG - Intronic
948481331 2:238252269-238252291 CATGCTTGCACTTCCTCACCCGG + Intronic
948497620 2:238362577-238362599 AAGGCCTGCCCTTCTCCTTCAGG + Intronic
1169083991 20:2815813-2815835 AATGACCACCCTTCTTCATCAGG + Exonic
1169274011 20:4221157-4221179 AAGGCCTGCCCCTCCTCTTCTGG - Exonic
1172766462 20:37353737-37353759 CAGGCCTGCCCCGCCTCATCTGG + Intronic
1172937943 20:38633950-38633972 ACTGCCTGCCCTTCCACAAGAGG - Intronic
1173634274 20:44541133-44541155 TATTCCTGCCCTTTCTAATCAGG + Intronic
1174795955 20:53522734-53522756 AATCCCAGCTCTTCCTCATGTGG + Intergenic
1175092660 20:56517821-56517843 AACGCAGGCCCTGCCTCATCAGG + Intronic
1180594193 22:16962922-16962944 TTGGCCTGCCCTTCCTCACCAGG - Intronic
1181102604 22:20551383-20551405 GATGACTGCGCTTCTTCATCTGG + Intronic
1183502405 22:38188809-38188831 AAATCCTGCCCTTCCTGACCAGG - Intronic
1183676646 22:39302564-39302586 AATGCCCACCCTTCCTGTTCAGG + Intergenic
1184884209 22:47332372-47332394 CCTGCCTGCCCTTCCTCTTGGGG - Intergenic
949485265 3:4531946-4531968 AATGCCTCCACTTTCTCATCTGG + Intronic
950025878 3:9819641-9819663 ACTGCCTGCCCTTTCCCTTCTGG + Intronic
950547213 3:13645659-13645681 TCTGCCTGCCCTTCCCCTTCAGG - Intergenic
950575340 3:13828853-13828875 AGTGCCTGCCCTTCTGCTTCAGG - Intronic
950628884 3:14268137-14268159 TCTGCCTGCCCTTCCCCAGCAGG + Intergenic
950900792 3:16495659-16495681 ACTGCCTGCCCTTTCCCTTCAGG - Intronic
952703008 3:36345746-36345768 ACTGCCTGTACTTCCTCAGCAGG - Intergenic
952971225 3:38651397-38651419 ACTGCCTGCACTTCCCCTTCTGG - Intergenic
953405000 3:42655612-42655634 AATGCGTGCCCCTCCCCATCCGG - Intronic
953951500 3:47194006-47194028 AATGCCTCCTCTACCTCATAGGG - Intergenic
955214413 3:56972938-56972960 AGTCCCTGCCATCCCTCATCTGG - Intronic
955922751 3:63974579-63974601 AAAGCCTTGGCTTCCTCATCTGG + Intronic
956013733 3:64859102-64859124 AATGCCTGCCCTTCTTAATTGGG - Intergenic
958616385 3:96498470-96498492 GAGGCATGCCCTTCTTCATCTGG + Intergenic
960969168 3:123126852-123126874 ACTCCCTGCCCTGCCTCACCTGG - Intronic
962696828 3:137957603-137957625 AAAGCCTGCTGTTCCTCATGTGG + Intergenic
966918645 3:184598325-184598347 AGTCCTTGCCCCTCCTCATCTGG + Intronic
969112099 4:4850555-4850577 CTTCCCTGCCTTTCCTCATCAGG + Intergenic
971884374 4:32424070-32424092 AATGCATGCCCTTCCCTTTCTGG - Intergenic
973023693 4:45238415-45238437 AATGCCTGCAAGTTCTCATCGGG + Intergenic
977795108 4:101155378-101155400 AATGCCTACCTTACCTCTTCAGG - Intronic
979677296 4:123423935-123423957 AGTGCCTGGGTTTCCTCATCTGG - Intergenic
979684527 4:123496719-123496741 ACTGCCTTCCCTTCCTCCACAGG + Intergenic
984693992 4:182760858-182760880 ATTGCCTGTCTTTCCTCTTCGGG - Intronic
989163073 5:38410043-38410065 CAAGCCTGCCTTTCCTCATGGGG + Intronic
989610174 5:43283312-43283334 GATGTCTGCCATTCCTCATGTGG + Intergenic
991384181 5:66066376-66066398 AGTGCCTGCCCTACCTCATGAGG + Intronic
992133565 5:73719788-73719810 AATGCTTGCCATTCCACAGCAGG + Intronic
992402917 5:76427967-76427989 AATGCCTGCAGTTCCTTACCTGG + Intronic
995281460 5:110340158-110340180 ACTGGCTGCCCTTCTTAATCAGG + Intronic
996337283 5:122398412-122398434 AAGGCCTGCCCTTCCAGTTCAGG - Intronic
997662938 5:135603480-135603502 GAGGCCTGTCCTGCCTCATCAGG - Intergenic
999288261 5:150407021-150407043 AATTCCAGCCCTTCCTCATCTGG - Intronic
1001580446 5:172794544-172794566 CGTGCCTGACCTTCCTCTTCTGG - Intergenic
1002294303 5:178221670-178221692 TGTCCCTGCCCTTCCTCCTCTGG + Intronic
1002436528 5:179235036-179235058 AATGCCTGCCCTGCCCTTTCTGG + Intronic
1002846709 6:953032-953054 CATGCCTGCCACTCCTCTTCTGG + Intergenic
1007276519 6:40678341-40678363 AAAGTCTCCCCTTCCCCATCTGG + Intergenic
1009918431 6:70025533-70025555 GATGCTTGTCCTTCCTCCTCAGG + Intronic
1010655933 6:78510975-78510997 AATGTCTTCCCTTCCACCTCGGG - Intergenic
1011116027 6:83893082-83893104 CATGCCTGCCCTTGCTCCTGAGG - Intronic
1015995175 6:138989240-138989262 AAAACCTGCCCTGCCTCATTTGG + Intergenic
1016936845 6:149454188-149454210 CATGCATTCCCTTCCTCATTAGG - Intronic
1019325225 7:434862-434884 AACGGCTGCTCTTCCCCATCCGG - Intergenic
1019855813 7:3606301-3606323 AATGACCGTCCTTTCTCATCTGG + Intronic
1021315665 7:19144828-19144850 AGAGTCTGCCCTTCCTCGTCTGG - Exonic
1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG + Intergenic
1026547935 7:71340231-71340253 AGAGACTGCCCTTTCTCATCTGG + Intronic
1028220694 7:88193188-88193210 AATGCCTCCACTTCCTGATGAGG + Exonic
1033124800 7:138698231-138698253 TCTGCCTGCATTTCCTCATCTGG + Intronic
1033324820 7:140368673-140368695 AGTGTCTGCTCTTCATCATCTGG + Intronic
1033651878 7:143350176-143350198 CCTCTCTGCCCTTCCTCATCAGG - Intronic
1035182258 7:157097833-157097855 TGTGCCTGCCCCTCCCCATCAGG - Intergenic
1035653948 8:1291548-1291570 AAGCCCTGCCATTCCTAATCCGG + Intergenic
1035774364 8:2176276-2176298 AGTCCCTGCCCTTCATCCTCTGG - Intergenic
1039271019 8:35880556-35880578 CATGCCTGCCCTTACACTTCTGG - Intergenic
1041572806 8:59356797-59356819 CTTCCCTTCCCTTCCTCATCTGG + Intergenic
1043974838 8:86572942-86572964 AATACCTGCCCTTCTTCCTCTGG - Intronic
1045873208 8:106949209-106949231 ATTGCCTGCCCTTTCTCAGTGGG + Intergenic
1046625711 8:116574810-116574832 AGTGCATGCTCTTCCTCAACTGG + Intergenic
1047355717 8:124119648-124119670 AGTGCCTGTACTACCTCATCTGG + Exonic
1047445755 8:124917924-124917946 AATGCCTAGCCTTCCTTAGCAGG - Intergenic
1048416034 8:134228943-134228965 TTTGCCTCCCCTTTCTCATCTGG - Intergenic
1049277377 8:141726514-141726536 AGTCCCTGCCCTTCTTCCTCTGG - Intergenic
1052816549 9:33106603-33106625 CATGCCAGCCCTCCCTCACCAGG + Intronic
1054772736 9:69098088-69098110 AGTGGCTGCCCTTCCTTAACAGG - Intronic
1055620580 9:78121156-78121178 GATGCCTGCCAGTCCACATCTGG - Intergenic
1055704788 9:78986199-78986221 AAAGATTGCCCTTCCTCTTCTGG + Intergenic
1058351606 9:104031537-104031559 AATGCCTTCCGTACCCCATCTGG + Intergenic
1058458114 9:105157319-105157341 GAGGCCTGCCCTCCATCATCTGG + Intergenic
1061199556 9:129129168-129129190 AATGCAGGCCCTTCCCCAACTGG - Intronic
1062359775 9:136182242-136182264 GAAGCCGGCCCTGCCTCATCTGG + Intergenic
1186307088 X:8273460-8273482 AATGCCTTCCCTTCCTAGACAGG - Intergenic
1188945128 X:36291156-36291178 AATGCTAGCTTTTCCTCATCAGG - Intronic
1190515502 X:51220034-51220056 AGTACCTGCCCCTCCACATCTGG + Intergenic
1194547091 X:95250226-95250248 ACTCCCTGACCTTCCTCTTCTGG - Intergenic
1195659209 X:107361808-107361830 CAGGCCTCCACTTCCTCATCTGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1199654770 X:149983350-149983372 AATTCCTGCCTCTCCTCTTCGGG + Intergenic