ID: 1090349889

View in Genome Browser
Species Human (GRCh38)
Location 11:126101239-126101261
Sequence CTGTGGCCCTCGAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090349889_1090349901 28 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349901 11:126101290-126101312 GATGTGCGGCTCCCCCAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 92
1090349889_1090349902 29 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349902 11:126101291-126101313 ATGTGCGGCTCCCCCAAGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 108
1090349889_1090349897 5 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349897 11:126101267-126101289 CAGTTGGGCACAGACAGCTTGGG 0: 1
1: 0
2: 1
3: 9
4: 179
1090349889_1090349900 25 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349900 11:126101287-126101309 GGGGATGTGCGGCTCCCCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 140
1090349889_1090349898 6 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349898 11:126101268-126101290 AGTTGGGCACAGACAGCTTGGGG 0: 1
1: 0
2: 3
3: 14
4: 190
1090349889_1090349896 4 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349896 11:126101266-126101288 GCAGTTGGGCACAGACAGCTTGG 0: 1
1: 0
2: 1
3: 17
4: 203
1090349889_1090349903 30 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349903 11:126101292-126101314 TGTGCGGCTCCCCCAAGGCGGGG 0: 1
1: 0
2: 1
3: 8
4: 94
1090349889_1090349894 -10 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349894 11:126101252-126101274 AGGGCCACAGCGGGGCAGTTGGG 0: 1
1: 0
2: 1
3: 12
4: 153
1090349889_1090349899 14 Left 1090349889 11:126101239-126101261 CCATCATCACTCGAGGGCCACAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1090349899 11:126101276-126101298 ACAGACAGCTTGGGGATGTGCGG 0: 1
1: 0
2: 2
3: 29
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090349889 Original CRISPR CTGTGGCCCTCGAGTGATGA TGG (reversed) Intergenic
900897988 1:5497237-5497259 TTGTGGCCCTTGAAGGATGAGGG - Intergenic
904895213 1:33812201-33812223 CTGTGGCCCTTCAGAGAGGAGGG - Intronic
905899943 1:41574742-41574764 CTGTGTCCCTGGTGTGATCAGGG - Intronic
906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG + Intergenic
909984117 1:82139607-82139629 CTGTGGCTCTCGTATAATGAAGG - Intergenic
913343142 1:117780218-117780240 CTGTGATCATCGAGTGATAATGG - Intergenic
914832573 1:151181179-151181201 CTGTGGCCATGCAGTGTTGAAGG - Intronic
918018697 1:180663909-180663931 CTGTGGCCCTATAGTGTTGGTGG - Intronic
919814679 1:201429936-201429958 GTGGGGCCATCGAGTGAGGAGGG - Intergenic
921097035 1:211895530-211895552 CTGTGGCCTTTCAGGGATGAAGG - Intergenic
1067126108 10:43516934-43516956 CTGTGTCCCTTTAGAGATGAAGG - Intergenic
1070596557 10:77836744-77836766 CTGTCACCCTCGAGTTTTGATGG - Intronic
1074260834 10:111851749-111851771 CTGTGGCCCTCTAGAGCTAAAGG - Intergenic
1075072702 10:119329396-119329418 CTGGGGACCTCGAGCCATGAGGG + Intronic
1076057273 10:127386042-127386064 CTGATGCCCGGGAGTGATGATGG + Intronic
1076465745 10:130680548-130680570 CTGTTTCCATTGAGTGATGAGGG + Intergenic
1077033150 11:479317-479339 GTGCGGCCCTTGAGTGATGGGGG + Intronic
1077380775 11:2236301-2236323 CTGTGGCCCTCCAGTTAGGGAGG + Intergenic
1077400979 11:2357275-2357297 CTGTGGCCCTCCAGTTAGGGAGG + Intergenic
1077555510 11:3224166-3224188 ATCTGGCCCTGGGGTGATGAGGG + Intergenic
1078512605 11:11996822-11996844 CTGTGGCCATTGTGTGATGGAGG - Intronic
1079423923 11:20322335-20322357 CTGTGGTCCTCTAGAGAGGACGG + Intergenic
1081584613 11:44375858-44375880 CTGTGGCCCAGGAATGATGGGGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083737657 11:64690802-64690824 CTGGGGGCCTCCAGTGCTGAGGG - Intronic
1084269601 11:68021914-68021936 CTTGGGCCCTCCAGTGAGGAGGG - Intronic
1084707141 11:70822125-70822147 CTTTGGCCCCCCAGTGATGGTGG - Intronic
1084814617 11:71638986-71639008 CTGTGGCCCACGCGTGGTGATGG - Intergenic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090250921 11:125251086-125251108 CTGTAGCCCCCGAGTCATCACGG + Intronic
1090349889 11:126101239-126101261 CTGTGGCCCTCGAGTGATGATGG - Intergenic
1090880170 11:130826030-130826052 CTTTGGCCCTAGACTGATGGGGG - Intergenic
1091458494 12:626235-626257 CTGTGTCCACCCAGTGATGAGGG + Intronic
1091798258 12:3309433-3309455 CTCAGGCCCTCAAGTGATGGGGG - Intergenic
1095169745 12:39020097-39020119 CTGTGGGCCTGGGGTGGTGATGG + Intergenic
1095953037 12:47791777-47791799 CTGGGGCCCATGAGAGATGAGGG - Intronic
1096545818 12:52339528-52339550 CTGTGGCCAGCAAGTGGTGAGGG + Intergenic
1103988796 12:124784693-124784715 CTGTGGCCCTAGGATGATGCAGG + Intronic
1104798290 12:131535202-131535224 ATGTGGCCCTGCAGTGATGGAGG + Intergenic
1104815654 12:131644174-131644196 CTGTGGCCCTGAAGAGAGGAAGG + Intergenic
1104987759 12:132606560-132606582 CTGTGGACTCCGGGTGATGATGG - Intronic
1105812073 13:24004480-24004502 CTGTGGCCATCCAGGGGTGAGGG + Intronic
1107140361 13:36991994-36992016 CTGTGGCCATTTTGTGATGAAGG + Intronic
1111940498 13:94601950-94601972 CTGTGGCCCTCACGTGCTGCTGG + Exonic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1118367620 14:65109178-65109200 CTGTGGCCCACGAGAGATGGCGG - Intergenic
1118785392 14:69041561-69041583 CTGTGTCCATCAACTGATGAAGG - Intergenic
1118818329 14:69328239-69328261 GTGTGACCCTGGAGTGATGGTGG + Intronic
1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG + Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1123984146 15:25630250-25630272 CTGTGGCCCTGTGGTGATGGGGG - Intergenic
1125365318 15:38907979-38908001 CAGTTGGCCTGGAGTGATGATGG - Intergenic
1125444243 15:39736606-39736628 CTGTGGCCCACGGGGGAGGAGGG - Intronic
1129271622 15:74422112-74422134 CTGAGGCCCACGTGTGATGGGGG + Intronic
1132227938 15:100157549-100157571 CTGTGGGCCTCCAGTCAGGAGGG - Intronic
1133110089 16:3542908-3542930 CTGTTGCCCTGGAGTGAGGAAGG - Intronic
1135550176 16:23391788-23391810 GTGAGGCCCTCCAGTGAAGAGGG + Intronic
1140470978 16:75214226-75214248 CTGTGGCCCCCGGGAGATGGGGG + Intergenic
1140742522 16:77954226-77954248 CTGTTGCCCTGGAGTGAAAAGGG + Intronic
1141428130 16:83956796-83956818 ATGTGGCCCTCGGGTGAGGCTGG + Intronic
1144769741 17:17752876-17752898 CTGAGGCACACGTGTGATGAGGG - Intronic
1146835418 17:36106827-36106849 CTGGGGCTCTGGAATGATGAGGG - Intergenic
1146902011 17:36594762-36594784 CAGTGCTCCCCGAGTGATGAAGG - Intronic
1151890825 17:76949508-76949530 CTGTGGTCCTCAAGTGTAGAGGG - Exonic
1152012566 17:77727373-77727395 CTGAGGGGCTTGAGTGATGATGG - Intergenic
1156187640 18:34681806-34681828 CTGTGGACTTCAGGTGATGATGG - Intronic
1157046587 18:44107515-44107537 CTGTGGCCATCCAGTGAGGAGGG - Intergenic
1159142051 18:64409162-64409184 CTGTGCCCCTCGTGTGGAGAAGG + Intergenic
1159447185 18:68555468-68555490 CTCTGGCCCTCTAGTGATATTGG + Intergenic
1159554704 18:69933077-69933099 CTGTGGCCCTGCAGTGAGGGAGG - Intronic
1160834292 19:1117292-1117314 CTGCGGCCTTCGAGGGCTGAGGG - Intronic
1161161044 19:2762095-2762117 CTGTGGCCCTGGGGTGATGGGGG - Intronic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1163289061 19:16366789-16366811 CCGTGGCCCTACAGTGATGCCGG - Intronic
1163696893 19:18768678-18768700 CTGTGGCCCACGAGTCAGGCTGG - Exonic
1163788416 19:19290199-19290221 CTGTGGCTCCCAAGTGATGGAGG + Intronic
1165057429 19:33186728-33186750 ATGTGGCCCTCCAGTGTTGGAGG - Intronic
1166356797 19:42232090-42232112 CTGGGGACCTCAAGTGAGGAGGG + Exonic
927507181 2:23622163-23622185 CTGGGGCACTCAAGTAATGAAGG + Intronic
933972858 2:87484123-87484145 CTGTGGCCCTGGGCTGATGTGGG - Intergenic
934131767 2:88955530-88955552 CTTAGGCCCTGGAGTGAGGAGGG - Intergenic
934133269 2:88970164-88970186 CTCAGGCCCTGGAGTGAGGAGGG - Intergenic
934234293 2:90216426-90216448 CTCAGGCCCTGGAGTGAGGAGGG + Intergenic
934897129 2:98128772-98128794 GTGTGGCCCTGGAGTGATTAGGG - Intronic
935128981 2:100247338-100247360 ATGTGGCCCTGGAATGATGAAGG + Intergenic
937027290 2:118710293-118710315 ATCTGGCCCTGGAGTGATTAGGG + Intergenic
937916967 2:127103998-127104020 CTGTGGCCTTGGTGTGAGGAGGG - Intronic
940306797 2:152235504-152235526 ATGGGGCCCTCGAGTACTGAGGG + Intergenic
942771374 2:179524998-179525020 ATGTCTGCCTCGAGTGATGATGG - Intronic
946419415 2:219556578-219556600 CTGGGGCCCTGGAGTGACGACGG + Exonic
1171381539 20:24737694-24737716 CTGTGTCCAGGGAGTGATGAGGG - Intergenic
1173334803 20:42103734-42103756 CTGAGTCCCTCCAGGGATGAAGG + Intronic
1173537301 20:43825394-43825416 CTGTAGCCCTAGAGTTATTAGGG + Intergenic
1175946922 20:62563297-62563319 CCCTGGCCCTGGAGTGAGGACGG - Intronic
1184215615 22:43065241-43065263 CTATGGCCTTTGGGTGATGATGG + Intronic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1185058250 22:48592257-48592279 CAGTGGCCCTGGAGTGAGGCTGG + Intronic
1185415771 22:50709355-50709377 CTCTGGCACTCGGGTCATGAGGG + Intergenic
950452638 3:13073749-13073771 CTCTGGCCCTGGAGTGAGGCCGG + Intergenic
950794020 3:15496067-15496089 GTGTGGCCTTCCACTGATGAAGG + Intronic
956665256 3:71636443-71636465 CTGTGGCACTCGATCGATGGGGG + Intergenic
957073082 3:75580741-75580763 CTGTGGACCAGGAGTGGTGATGG + Intergenic
961472227 3:127122759-127122781 CTGTGGCCCTCCAGTTCTGGTGG - Intergenic
967841743 3:194010449-194010471 CAGTGGCCCTGGAATGATGCTGG - Intergenic
972961307 4:44456119-44456141 CTGTTTCACTCGAGTTATGATGG - Intergenic
975335511 4:73170745-73170767 CTGTGGGCCTCTGGTGGTGACGG + Intronic
982544129 4:156711500-156711522 CTCTGCCCATCGAGAGATGAGGG + Intergenic
986533994 5:8767490-8767512 CAGGGGCCCTCGTGAGATGATGG + Intergenic
995147970 5:108807964-108807986 CTGTGGCCCAAGAGTGTTGTTGG + Intronic
995709084 5:115016458-115016480 CTATGGACTTTGAGTGATGATGG + Intergenic
997591014 5:135072397-135072419 CTTTGGCCCTCATGTGAAGAGGG - Intronic
1003584666 6:7376518-7376540 CAGAGACCCTCGAGTGATGCTGG + Intronic
1007057499 6:38902380-38902402 ATGTGGCCCTGGGGTGATTAGGG - Intronic
1007250366 6:40491002-40491024 CTGTGGCCATAGAGGGGTGAGGG + Intronic
1013418943 6:109949035-109949057 CTCTGGCCCTGGACTGATGAGGG + Intergenic
1015738787 6:136430984-136431006 CTATGGACTTCGGGTGATGATGG - Intronic
1018937632 6:168284032-168284054 CCGTGCCCCTCGGGTGATCATGG - Intergenic
1019361575 7:607604-607626 CTCTGGCCTTCGGGTCATGAAGG - Intronic
1023843985 7:44111049-44111071 CTGTGGCCCGTGAGTGTGGAGGG + Exonic
1027673636 7:81132527-81132549 ATGTGGACCTCGAGGGATGCTGG + Intergenic
1029960002 7:104680552-104680574 CTATGGCCCTTGAGGGATAATGG - Intronic
1031694985 7:124839839-124839861 CTGTGGACTTTGAGTGATAATGG - Intronic
1034500065 7:151444443-151444465 CTCTGGCCCTGCTGTGATGAGGG - Intergenic
1035741951 8:1935309-1935331 CAGTGGACCCTGAGTGATGAGGG - Intronic
1036757507 8:11481027-11481049 TTGTGTCCATCGAGTGATGCTGG + Intergenic
1038942326 8:32318967-32318989 ATCTGGGCCTCAAGTGATGAAGG - Intronic
1039479234 8:37859471-37859493 CTGTGGACCCCGATTGGTGAGGG - Exonic
1042473104 8:69213716-69213738 ACCTGGCCCTTGAGTGATGAGGG - Intergenic
1042670963 8:71262988-71263010 TGGTGGCTCTGGAGTGATGATGG - Intronic
1049256696 8:141617903-141617925 ATGTGTCCCTGGAGTGATGGAGG + Intergenic
1051086019 9:13349839-13349861 CTATGGACCTCAAGTGATAATGG - Intergenic
1054876908 9:70106844-70106866 CTGTGTCCCTCATGTGAGGATGG + Intronic
1060459407 9:123835442-123835464 CTGTGTCCCTCTAGTAATGAAGG + Intronic
1061130672 9:128706162-128706184 CTGTGGCCCTGATATGATGACGG + Intronic
1061298780 9:129692403-129692425 CTATGGACTTTGAGTGATGATGG - Intronic
1062448408 9:136605274-136605296 CTGTGGCCCTCCTGAGATCACGG + Intergenic
1186798802 X:13072382-13072404 CTGGGGGCCTCTAGTGAAGAAGG + Intergenic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1192249748 X:69401939-69401961 CAGTGGCCCTCAAATGATGTTGG - Intergenic
1192792893 X:74400467-74400489 CTGTGGACTTTGAGTGATAATGG + Intergenic
1197661483 X:129178704-129178726 CTGTGGGCCTGAAGTGATGGTGG - Intergenic