ID: 1090351404

View in Genome Browser
Species Human (GRCh38)
Location 11:126110765-126110787
Sequence ACTCTGGGTCCCGGGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090351393_1090351404 30 Left 1090351393 11:126110712-126110734 CCAAGGCTGCACACTGGCTCTTG No data
Right 1090351404 11:126110765-126110787 ACTCTGGGTCCCGGGGTCCTTGG No data
1090351395_1090351404 -3 Left 1090351395 11:126110745-126110767 CCTGCATCTATGCCCTCCACACT No data
Right 1090351404 11:126110765-126110787 ACTCTGGGTCCCGGGGTCCTTGG No data
1090351394_1090351404 4 Left 1090351394 11:126110738-126110760 CCTGCGTCCTGCATCTATGCCCT No data
Right 1090351404 11:126110765-126110787 ACTCTGGGTCCCGGGGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090351404 Original CRISPR ACTCTGGGTCCCGGGGTCCT TGG Intergenic