ID: 1090354484

View in Genome Browser
Species Human (GRCh38)
Location 11:126130695-126130717
Sequence CTGTTTAGGGGTACGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090354484_1090354496 23 Left 1090354484 11:126130695-126130717 CCTTCCACCGTACCCCTAAACAG No data
Right 1090354496 11:126130741-126130763 GGTTAGACTGCCATTCATCTGGG No data
1090354484_1090354493 2 Left 1090354484 11:126130695-126130717 CCTTCCACCGTACCCCTAAACAG No data
Right 1090354493 11:126130720-126130742 GGACCATTACAGCACTTTTCGGG No data
1090354484_1090354495 22 Left 1090354484 11:126130695-126130717 CCTTCCACCGTACCCCTAAACAG No data
Right 1090354495 11:126130740-126130762 GGGTTAGACTGCCATTCATCTGG No data
1090354484_1090354492 1 Left 1090354484 11:126130695-126130717 CCTTCCACCGTACCCCTAAACAG No data
Right 1090354492 11:126130719-126130741 GGGACCATTACAGCACTTTTCGG No data
1090354484_1090354497 26 Left 1090354484 11:126130695-126130717 CCTTCCACCGTACCCCTAAACAG No data
Right 1090354497 11:126130744-126130766 TAGACTGCCATTCATCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090354484 Original CRISPR CTGTTTAGGGGTACGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr