ID: 1090359047

View in Genome Browser
Species Human (GRCh38)
Location 11:126160211-126160233
Sequence CTTTCTCTGCAGGCCCTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090359043_1090359047 -10 Left 1090359043 11:126160198-126160220 CCTTATCCTCAACCTTTCTCTGC No data
Right 1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG No data
1090359038_1090359047 18 Left 1090359038 11:126160170-126160192 CCGTACCGCTGCAGCTTTCCTCA No data
Right 1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG No data
1090359041_1090359047 0 Left 1090359041 11:126160188-126160210 CCTCAGTGGCCCTTATCCTCAAC No data
Right 1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG No data
1090359035_1090359047 21 Left 1090359035 11:126160167-126160189 CCCCCGTACCGCTGCAGCTTTCC No data
Right 1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG No data
1090359042_1090359047 -9 Left 1090359042 11:126160197-126160219 CCCTTATCCTCAACCTTTCTCTG No data
Right 1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG No data
1090359037_1090359047 19 Left 1090359037 11:126160169-126160191 CCCGTACCGCTGCAGCTTTCCTC No data
Right 1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG No data
1090359036_1090359047 20 Left 1090359036 11:126160168-126160190 CCCCGTACCGCTGCAGCTTTCCT No data
Right 1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG No data
1090359040_1090359047 13 Left 1090359040 11:126160175-126160197 CCGCTGCAGCTTTCCTCAGTGGC No data
Right 1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090359047 Original CRISPR CTTTCTCTGCAGGCCCTGCA CGG Intergenic
No off target data available for this crispr