ID: 1090360355

View in Genome Browser
Species Human (GRCh38)
Location 11:126168020-126168042
Sequence GGTGTGGAGCCACAGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090360355_1090360362 4 Left 1090360355 11:126168020-126168042 CCAGGTCCCTGTGGCTCCACACC No data
Right 1090360362 11:126168047-126168069 CACAAATTGGAACAATGCATTGG No data
1090360355_1090360359 -9 Left 1090360355 11:126168020-126168042 CCAGGTCCCTGTGGCTCCACACC No data
Right 1090360359 11:126168034-126168056 CTCCACACCTGGTCACAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090360355 Original CRISPR GGTGTGGAGCCACAGGGACC TGG (reversed) Intergenic
No off target data available for this crispr