ID: 1090360863

View in Genome Browser
Species Human (GRCh38)
Location 11:126171802-126171824
Sequence CTTGGTGCCCAGTCAGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090360863_1090360866 -9 Left 1090360863 11:126171802-126171824 CCACATCCTGACTGGGCACCAAG No data
Right 1090360866 11:126171816-126171838 GGCACCAAGGCCCTCACGCTCGG No data
1090360863_1090360867 -8 Left 1090360863 11:126171802-126171824 CCACATCCTGACTGGGCACCAAG No data
Right 1090360867 11:126171817-126171839 GCACCAAGGCCCTCACGCTCGGG No data
1090360863_1090360871 14 Left 1090360863 11:126171802-126171824 CCACATCCTGACTGGGCACCAAG No data
Right 1090360871 11:126171839-126171861 GCCCTCTCCAGCCTCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090360863 Original CRISPR CTTGGTGCCCAGTCAGGATG TGG (reversed) Intergenic
No off target data available for this crispr