ID: 1090363495

View in Genome Browser
Species Human (GRCh38)
Location 11:126188731-126188753
Sequence TAGGGGCCCGGGCTGTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090363495_1090363506 9 Left 1090363495 11:126188731-126188753 CCAACACACAGCCCGGGCCCCTA No data
Right 1090363506 11:126188763-126188785 TGGACAAATGAGATGCGGTCAGG No data
1090363495_1090363505 4 Left 1090363495 11:126188731-126188753 CCAACACACAGCCCGGGCCCCTA No data
Right 1090363505 11:126188758-126188780 ATGGGTGGACAAATGAGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090363495 Original CRISPR TAGGGGCCCGGGCTGTGTGT TGG (reversed) Intergenic
No off target data available for this crispr