ID: 1090364407

View in Genome Browser
Species Human (GRCh38)
Location 11:126193524-126193546
Sequence GAGGGGTCCTCAGACCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090364407_1090364416 12 Left 1090364407 11:126193524-126193546 CCTAAGGGGTCTGAGGACCCCTC No data
Right 1090364416 11:126193559-126193581 ACAGGCCGTGGGAGCGGCAGAGG No data
1090364407_1090364415 6 Left 1090364407 11:126193524-126193546 CCTAAGGGGTCTGAGGACCCCTC No data
Right 1090364415 11:126193553-126193575 TGTCAGACAGGCCGTGGGAGCGG No data
1090364407_1090364409 -6 Left 1090364407 11:126193524-126193546 CCTAAGGGGTCTGAGGACCCCTC No data
Right 1090364409 11:126193541-126193563 CCCCTCAGTCCATGTCAGACAGG No data
1090364407_1090364419 27 Left 1090364407 11:126193524-126193546 CCTAAGGGGTCTGAGGACCCCTC No data
Right 1090364419 11:126193574-126193596 GGCAGAGGATCCTGCAGGAATGG No data
1090364407_1090364413 1 Left 1090364407 11:126193524-126193546 CCTAAGGGGTCTGAGGACCCCTC No data
Right 1090364413 11:126193548-126193570 GTCCATGTCAGACAGGCCGTGGG No data
1090364407_1090364418 22 Left 1090364407 11:126193524-126193546 CCTAAGGGGTCTGAGGACCCCTC No data
Right 1090364418 11:126193569-126193591 GGAGCGGCAGAGGATCCTGCAGG No data
1090364407_1090364412 0 Left 1090364407 11:126193524-126193546 CCTAAGGGGTCTGAGGACCCCTC No data
Right 1090364412 11:126193547-126193569 AGTCCATGTCAGACAGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090364407 Original CRISPR GAGGGGTCCTCAGACCCCTT AGG (reversed) Intergenic
No off target data available for this crispr