ID: 1090364412

View in Genome Browser
Species Human (GRCh38)
Location 11:126193547-126193569
Sequence AGTCCATGTCAGACAGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090364407_1090364412 0 Left 1090364407 11:126193524-126193546 CCTAAGGGGTCTGAGGACCCCTC No data
Right 1090364412 11:126193547-126193569 AGTCCATGTCAGACAGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090364412 Original CRISPR AGTCCATGTCAGACAGGCCG TGG Intergenic
No off target data available for this crispr