ID: 1090366620

View in Genome Browser
Species Human (GRCh38)
Location 11:126211829-126211851
Sequence CGGTGAGTGTGTAGGGAAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090366613_1090366620 17 Left 1090366613 11:126211789-126211811 CCGGTAGCTGCAGCTGGAGCAGT 0: 1
1: 0
2: 4
3: 30
4: 346
Right 1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG 0: 1
1: 0
2: 0
3: 27
4: 246
1090366612_1090366620 21 Left 1090366612 11:126211785-126211807 CCGGCCGGTAGCTGCAGCTGGAG 0: 1
1: 0
2: 2
3: 17
4: 190
Right 1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG 0: 1
1: 0
2: 0
3: 27
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090366620 Original CRISPR CGGTGAGTGTGTAGGGAAGC CGG Exonic
903233810 1:21937134-21937156 CGGTGAGTGTGCGGGGCAGAGGG - Exonic
903668695 1:25022885-25022907 GGGAGAGGGGGTAGGGAAGCAGG - Intergenic
905303591 1:37002434-37002456 CGGAGAGTGGGTTGAGAAGCAGG + Intronic
905967037 1:42107311-42107333 TGGTGAGTATGTGGGTAAGCTGG - Intergenic
906346034 1:45014937-45014959 CAGGGAGTGTGTGGGGAAGACGG + Exonic
907069216 1:51519051-51519073 CGGTGTGTGTGAGGGAAAGCGGG - Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
915393087 1:155562183-155562205 CGATGAGAGTGCAGGGAAGTGGG + Exonic
917869481 1:179229220-179229242 TGGTGAGTGTGTCTGGGAGCCGG - Exonic
920666196 1:207964262-207964284 CGGTGAGAGTGGAGGGTGGCGGG + Intergenic
921358872 1:214312268-214312290 GGATCAGTGTGGAGGGAAGCGGG + Intronic
922732222 1:227954923-227954945 CGGTGAGTGTGTGGAGAAACTGG - Intergenic
922784154 1:228274840-228274862 AGGTGAGTGTGGGGGGCAGCAGG + Exonic
923068413 1:230540860-230540882 GAGTGAGAGCGTAGGGAAGCTGG + Intergenic
924371764 1:243358468-243358490 CGGTGAGGATGTAGAGAAACTGG + Intronic
1064301716 10:14128841-14128863 GGGTGAGAGTGTAGGGCAGATGG - Intronic
1065250311 10:23804359-23804381 AGGTGAGTGTGATAGGAAGCTGG + Intronic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1068152882 10:53156691-53156713 TGGTGAGGCTGTAGGGAAGTAGG + Intergenic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1071334499 10:84589864-84589886 CTGTGCGGGTGTAGGGAAGGTGG + Intergenic
1071667674 10:87576657-87576679 AGGTGAGTGGGTACGGGAGCTGG - Intergenic
1071761569 10:88613498-88613520 TGGAGAGTGTATAGGGAAGAGGG + Intergenic
1072026104 10:91459214-91459236 TGGTGAGTATGTAGAGAAACTGG + Intronic
1075544277 10:123342787-123342809 AGGTGACTGAGAAGGGAAGCGGG - Intergenic
1076376506 10:129991571-129991593 CGGTGAGGATGTGGGGAAACTGG + Intergenic
1076622506 10:131801084-131801106 CTGTGAGCGAGTAGGGAAGCAGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078778970 11:14419315-14419337 CAGTGAGTGTGTCAGGAAGCCGG + Intergenic
1081961787 11:47143248-47143270 AGGTATGTGTGTGGGGAAGCTGG - Intronic
1081991782 11:47341970-47341992 CGGTGAGTGTGCAGGGCAGGTGG - Exonic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083951480 11:65959031-65959053 GGCTGAGTGGGTAGGGAAGCAGG + Intronic
1084194933 11:67519122-67519144 CGGTGAGCCTGTACAGAAGCTGG - Exonic
1084676008 11:70635060-70635082 TGGTGAGTATGTGGGGAAACTGG + Intronic
1084746972 11:71177936-71177958 TGGTGAGTATGTAGAGAAACTGG + Intronic
1086758308 11:90593270-90593292 AGGTGAGTGGATAGGGAAGTAGG + Intergenic
1089109710 11:116045595-116045617 TGGTGAGTGAGTAGGGTTGCTGG - Intergenic
1089403052 11:118175916-118175938 AGGAGAGTGTGCAGGGGAGCTGG - Intronic
1089632729 11:119793708-119793730 GGGTGAGTGTGTGGGGTGGCAGG + Intergenic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1095207164 12:39451435-39451457 TGGTGTGTGTGTTGGGAAGTAGG - Intergenic
1096253282 12:50047289-50047311 TGATGAGTGTGAGGGGAAGCTGG - Intergenic
1097088346 12:56486300-56486322 AGGTGTGTGTGTGGGGAACCAGG + Intronic
1097966531 12:65587364-65587386 CGGTCATTATGGAGGGAAGCAGG + Intergenic
1098603351 12:72360588-72360610 TGGTGAGGATGTGGGGAAGCAGG + Intronic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1103174188 12:118847651-118847673 CAGTGACTGTGTAGGGAGGCTGG + Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1104849153 12:131863107-131863129 CGGTGAGTGGGTGGGTCAGCGGG - Intergenic
1112546179 13:100373290-100373312 CGGTGAGGGTGTGGAGAAGCTGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113898776 13:113784159-113784181 CGGGGAGGGTGTAGGGATGTGGG + Intronic
1114300179 14:21368912-21368934 GGGTAAGTGTGTAGGGGGGCAGG + Intronic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1119832226 14:77713480-77713502 CGGTGAAGGTGTAGGGAATCTGG + Intronic
1120687713 14:87557473-87557495 GGGTGAGTGAGTAGGCAAGCTGG + Intergenic
1122630810 14:103107011-103107033 GGGTGTGTGTGTAGGGTAGTGGG + Intronic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1123037564 14:105477709-105477731 GGGTGTGTGTGGGGGGAAGCGGG + Intronic
1123102060 14:105811026-105811048 AGGTGAAGGTGAAGGGAAGCAGG + Intergenic
1123439895 15:20282580-20282602 GGATCAGTGTGAAGGGAAGCTGG - Intergenic
1123926700 15:25120004-25120026 CTGTGAGGCTGTAGGAAAGCTGG - Intergenic
1130388635 15:83435241-83435263 GGGTGTGTGTGTACAGAAGCGGG + Intergenic
1132501499 16:286472-286494 CTGTGAGTGTTGAGGGAGGCAGG + Exonic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1133300259 16:4778065-4778087 CGGTGAGGGTGTGGGGAGCCTGG - Exonic
1133321857 16:4919061-4919083 CGGTGTGTGTGTGGGGAGGGGGG - Intronic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1135414751 16:22260528-22260550 GGGTGAGTGTGAAGGGAGGGAGG + Exonic
1135778225 16:25275817-25275839 CTGTGCATGTGTAGGGAAGGGGG + Intergenic
1136076465 16:27820592-27820614 CGGTGAATGTGTAAGGAGCCAGG + Intronic
1136845276 16:33571817-33571839 GGATCAGTGTGAAGGGAAGCTGG + Intergenic
1138125567 16:54435705-54435727 AGCTGGGTGTGTTGGGAAGCTGG + Intergenic
1139898340 16:70306871-70306893 TGGGGAGTTTGTAGGGAAACAGG - Intronic
1141125823 16:81400283-81400305 CAGTGAGTGTGTGGGGAAAGGGG - Intergenic
1141133926 16:81453577-81453599 CGGTGTGTGTGTTGGTAAACAGG - Intronic
1141349879 16:83284972-83284994 GGGAGAGTGTGTATAGAAGCTGG - Intronic
1142110333 16:88327693-88327715 CAGTGAGTGTGCACGGAAGGTGG - Intergenic
1203106984 16_KI270728v1_random:1420470-1420492 GGATCAGTGTGAAGGGAAGCTGG + Intergenic
1203155444 16_KI270728v1_random:1872115-1872137 GGATCAGTGTGAAGGGAAGCTGG + Intergenic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143718253 17:8791414-8791436 TGGTGAGGGTGTAGAGAAGCTGG + Intergenic
1149582911 17:57763619-57763641 TGGTGAGGATGTAGGGAAACAGG + Intergenic
1151015761 17:70551006-70551028 GTGTGTGTGTGTATGGAAGCTGG + Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1156481925 18:37441738-37441760 TGGTGAGTGGGGAGGCAAGCTGG - Intronic
1156518466 18:37700852-37700874 AGGAGAGTGTGTAGGGAAAGAGG + Intergenic
1157189677 18:45570305-45570327 AGGTGAGGGTGTAGGGAGTCTGG - Intronic
1157605343 18:48922854-48922876 GGAAGACTGTGTAGGGAAGCGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1160277099 18:77447114-77447136 CTGTGAATGTGTTGGGAATCAGG + Intergenic
1160446717 18:78933890-78933912 AGGTGAGTGTGTAGCACAGCAGG - Intergenic
1161770038 19:6226090-6226112 CGGTGAGTCTGTGAGGCAGCTGG + Intronic
1161800680 19:6415513-6415535 CGGTGAGTCTGCAGGGTGGCGGG - Exonic
1162858302 19:13486904-13486926 GGCTGCGTGTGTAGGGAAGAAGG - Intronic
1163635734 19:18436512-18436534 TGGAGAGGGTGTAGGGAAGTTGG + Intronic
1164069163 19:21750650-21750672 CGGCGAGCGTGCAGGGAGGCCGG + Intronic
1164471827 19:28542675-28542697 CGGTGAGGGTGTAGGGGAAATGG - Intergenic
927017838 2:18985155-18985177 CGGTGAGTATGTGGAGAAACTGG - Intergenic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
931239705 2:60441240-60441262 CAGTGAGTGTGCTGGGAAGACGG - Intergenic
932333749 2:70917496-70917518 TGGTGAGGATGCAGGGAAGCTGG - Intronic
932654641 2:73599690-73599712 GGGCAAGAGTGTAGGGAAGCGGG + Intronic
933043388 2:77499402-77499424 AGGTAAGTGTGTAGAGAACCGGG - Intronic
933353989 2:81192587-81192609 CTGTGAATGGGTAGGGAATCTGG + Intergenic
933999027 2:87691279-87691301 TGGTGAGAATGTAGGGAAACTGG - Intergenic
934676710 2:96254443-96254465 AGGCGGGTCTGTAGGGAAGCAGG + Intronic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
935664528 2:105498588-105498610 CGGTCAGTGTGTTGCAAAGCTGG - Intergenic
935685871 2:105682050-105682072 CGGAGAGAGTGGAGGGAAACAGG + Intergenic
935931882 2:108135457-108135479 GGGGGAGTGTGTAAGGAATCTGG - Intergenic
936294817 2:111259604-111259626 TGGTGAGAATGTAGGGAAACTGG + Intergenic
936951210 2:117979346-117979368 TGGAGGGTGAGTAGGGAAGCAGG - Intronic
937282323 2:120727839-120727861 TGGTGAGGCTGTAGGGAAACAGG - Intergenic
938107531 2:128543596-128543618 GGGTGAGGGAGTCGGGAAGCAGG + Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939630334 2:144520966-144520988 GGGAGAGTGTGTAGGGAGGCAGG + Intronic
943213274 2:184996878-184996900 TGGTGTGTGTGTATGGGAGCAGG - Intergenic
944592592 2:201231800-201231822 TGGTGAGGGTGTGGGGAAGTGGG + Intergenic
945363820 2:208926627-208926649 TGGTGAGTATGAAGAGAAGCTGG + Intergenic
946355658 2:219182718-219182740 GGGGCAGTGTGTGGGGAAGCTGG + Exonic
946395393 2:219441748-219441770 CGGTGGTCGTGTAGGGAGGCAGG + Intronic
947469853 2:230391352-230391374 TGGTGAGTGTGTAGAGAAATGGG - Intronic
947544083 2:230998734-230998756 TGGTGAGGATGTAGAGAAGCTGG + Intronic
947774509 2:232697233-232697255 TGGAGAGTGGGGAGGGAAGCGGG + Intergenic
1169133148 20:3178019-3178041 TGGTGAGGCTGTAGGGAAACAGG - Intergenic
1169197061 20:3689019-3689041 GGGAGAGTGTGCAGGGAACCAGG - Intronic
1172789529 20:37493209-37493231 TGGTGAGGGTGTAGAGAAGAGGG + Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1174769103 20:53281719-53281741 CAGTAAGGGAGTAGGGAAGCAGG + Intronic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175813371 20:61870648-61870670 CAGTGAGTGCTTCGGGAAGCTGG + Intronic
1179547257 21:42121091-42121113 CGATGAGTGTGAAAGGAAGGAGG + Exonic
1183046679 22:35226177-35226199 CGCTGAGTGTCTCTGGAAGCCGG + Intergenic
1183689986 22:39382991-39383013 CGGTGAGTGAGTGGCAAAGCTGG + Exonic
1183782310 22:40006767-40006789 CGCTGAGTGGGCAGGGAAACGGG + Intronic
1184271558 22:43387380-43387402 CGGTGACTGTGGAGGCCAGCAGG - Intergenic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184658318 22:45953134-45953156 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658327 22:45953166-45953188 CGGTGGCTGTGAGGGGAAGCCGG - Intronic
1184658358 22:45953314-45953336 TGGTGACTGTGAGGGGAAGCGGG - Intronic
1184658366 22:45953342-45953364 CGGTGGCTGTGAGGGGAAGCTGG - Intronic
1184696393 22:46141487-46141509 GGATCAGTGTGAAGGGAAGCTGG - Intergenic
949392898 3:3582520-3582542 TGGTGAGGGTGTAGGGCACCAGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949863837 3:8530910-8530932 TGTGGAGTGTGGAGGGAAGCAGG - Intronic
949893464 3:8751014-8751036 CGGTGAGGATGTAGAGAAACTGG - Exonic
950116950 3:10457053-10457075 TGGTGAGTGTGGATGTAAGCAGG + Intronic
951336623 3:21430678-21430700 CAGTGTGTGTCTAGAGAAGCGGG - Intronic
952960560 3:38586707-38586729 GGGGGAGTGTGTAGGAAGGCAGG - Intronic
954647090 3:52138177-52138199 CGTGGAGTGTGTAGAGCAGCCGG + Exonic
955039913 3:55306189-55306211 CGGTGAGTCTGTTTGAAAGCAGG - Intergenic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957911719 3:86626452-86626474 GGGTGAGTGTGTATGGCAGTAGG + Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
959024837 3:101229317-101229339 TGGTGTGTGTGTGGGGGAGCAGG - Intronic
960616592 3:119601039-119601061 CGGTGCATGTGTCGGGAAGCAGG - Intronic
963505166 3:146175864-146175886 AGGTGAGTGTGTAGGAGAGAGGG - Intergenic
967787072 3:193508708-193508730 TGGGGAGTGGGTAGGAAAGCAGG + Intronic
968577165 4:1372895-1372917 CAGTGAGTGTGTAGAGACGCGGG - Intronic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
978576337 4:110194089-110194111 CATTGAGTGAGAAGGGAAGCTGG - Intronic
979683143 4:123483280-123483302 CTGTGAGAGTTTAGAGAAGCAGG - Intergenic
981080433 4:140634478-140634500 ATGTGAGTGTGTAGGTAAGGGGG - Intronic
981490077 4:145330176-145330198 TGGTGAGGTTGTAGGGAAGCTGG + Intergenic
982802699 4:159723479-159723501 CCTTGAGTGTGCAGGGATGCTGG + Intergenic
983798893 4:171902621-171902643 CAGTGAGAGGGTAGGGAGGCTGG + Intronic
984417484 4:179479705-179479727 GGTTGTGTGTGTGGGGAAGCGGG - Intergenic
985612300 5:897148-897170 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612314 5:897214-897236 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612328 5:897280-897302 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612357 5:897412-897434 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612372 5:897478-897500 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612387 5:897544-897566 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612402 5:897610-897632 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612417 5:897676-897698 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612432 5:897742-897764 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612447 5:897808-897830 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612462 5:897874-897896 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612477 5:897940-897962 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612492 5:898006-898028 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612507 5:898072-898094 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612522 5:898138-898160 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612537 5:898204-898226 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612552 5:898270-898292 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612567 5:898336-898358 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612582 5:898402-898424 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612597 5:898468-898490 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612612 5:898534-898556 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612627 5:898600-898622 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612642 5:898666-898688 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612657 5:898732-898754 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612672 5:898798-898820 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612687 5:898864-898886 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612702 5:898930-898952 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612717 5:898996-899018 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612732 5:899062-899084 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612747 5:899128-899150 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612762 5:899194-899216 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612777 5:899260-899282 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612792 5:899326-899348 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612807 5:899392-899414 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612822 5:899458-899480 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612837 5:899524-899546 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612852 5:899590-899612 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612867 5:899656-899678 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612882 5:899722-899744 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612897 5:899788-899810 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612927 5:899916-899938 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985612941 5:899982-900004 CAGTCAGTGTGTGGGGAAACAGG + Intronic
985621400 5:957983-958005 AGCTGAGGGTGTGGGGAAGCAGG + Intergenic
986028222 5:3871025-3871047 GGGTGAGGGTGGTGGGAAGCTGG + Intergenic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
991443892 5:66679701-66679723 CGGTGAGGGTGTGGGGTTGCAGG + Intronic
992507106 5:77397912-77397934 TGGTTAGTGTGTGGGGAGGCGGG - Intronic
996281567 5:121735820-121735842 AGGTGAATGTGTGGGGAAACAGG + Intergenic
998389572 5:141778820-141778842 AGGGGAGTCTGTAGGGAAGCTGG - Intergenic
998389808 5:141780224-141780246 AGGGGAGTCTGTAGGGAAGCTGG - Intergenic
999282347 5:150374048-150374070 TGGGGAGTGGGGAGGGAAGCAGG + Intronic
1000302135 5:159965751-159965773 TGGTGAAAGTCTAGGGAAGCAGG + Intronic
1001715070 5:173808709-173808731 TGGTGAGTGTGTGGGGAGGCGGG - Intergenic
1001809527 5:174617425-174617447 TGGTGAGTTTGTAGGGGAGCAGG - Intergenic
1005079947 6:21946782-21946804 TGGTTTGTGTGTAAGGAAGCAGG + Intergenic
1006670639 6:35727930-35727952 CGGTGAGTGGGCAGGGCTGCGGG + Intronic
1007279132 6:40697419-40697441 CGGAGAGGGTGTAGGGAAGGTGG + Intergenic
1011032679 6:82940675-82940697 CTGAGAGTGGGTAGGGAAGAAGG - Intronic
1011557848 6:88588141-88588163 CAGTGGGTGGGTTGGGAAGCGGG - Intergenic
1014019713 6:116572984-116573006 GGGTGAGTGTGTATGGAGTCTGG + Intronic
1014107469 6:117583103-117583125 GAGGGAGTGTGTAGGCAAGCAGG - Intronic
1014992229 6:128094988-128095010 AGGTGAGTTTGAAGGGAAGGTGG + Intronic
1016590076 6:145735055-145735077 CGGGGAGTGCGCAGGGACGCGGG + Intronic
1016706928 6:147119724-147119746 CAATTAGTGTGTAGGGTAGCTGG - Intergenic
1018151553 6:160944646-160944668 TGATGAGTGTCTAGGGAAGCAGG + Intergenic
1018967582 6:168500576-168500598 CGGTGATTCTGTAGGGACCCCGG + Intronic
1025928763 7:65979286-65979308 CTGTGAGGGTGTAGAGATGCTGG + Intronic
1030124205 7:106139180-106139202 CGGTGAGTTTGGAAGGGAGCAGG + Intergenic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1036086533 8:5618645-5618667 GGGTGTGTGTGTGGGGGAGCGGG + Intergenic
1036086548 8:5618699-5618721 GGGTGTGTGTGTGGGGGAGCGGG + Intergenic
1037102749 8:15067213-15067235 GGTGGAGTGTGTAGGCAAGCCGG - Intronic
1037916620 8:22777062-22777084 AGGTGAGTGTGCAGAGAAGCAGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1042648482 8:71013359-71013381 GGGAGAGTGTGTAGGCAACCTGG - Intergenic
1044850821 8:96425506-96425528 AGGTGAGTGTGCATGGATGCTGG + Intergenic
1045097041 8:98808842-98808864 AGGGGAGTGGGTAGGGAAGCTGG + Intronic
1048148253 8:131866809-131866831 TGGTAAGTATGTAGGGAAACTGG + Intergenic
1049140250 8:140948092-140948114 CTGTAAGTGTATAGGGAAGCAGG - Intronic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1049698599 8:143996031-143996053 GGGGGAGGGTTTAGGGAAGCGGG - Intronic
1051075537 9:13230160-13230182 TGGTGAGGATGTAGAGAAGCTGG + Intronic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG + Intronic
1060231344 9:121827592-121827614 CAGTGAGTGTGGGGGGACGCGGG + Intronic
1186128567 X:6442442-6442464 AGGTGAGTGGGTACAGAAGCTGG + Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1187500181 X:19832908-19832930 CAGTGACTGTGGAGGGAACCAGG - Intronic
1187936482 X:24341187-24341209 AGGTGAGTGGGCAGGGAAGATGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1190212917 X:48461697-48461719 CGGTGAGTGGGCAGGCAAGTGGG - Exonic
1191955554 X:66639180-66639202 CTGTGAGTGTGTATGCAGGCTGG - Intronic
1194657994 X:96597004-96597026 AGGTGTGTGTGCAGGGAAGGGGG - Intergenic
1195155659 X:102121253-102121275 TGGTGAGTGTGTGGAGAAACAGG + Intergenic
1196801490 X:119547400-119547422 TGGTGAGACTGTAGGGAAACAGG - Intronic
1197469003 X:126843752-126843774 TGGTGAGTATGTAGAGAAGAGGG + Intergenic
1197909870 X:131470472-131470494 CGGTGAGGGTGTAGAGAAAAGGG - Intergenic
1200097131 X:153669686-153669708 CGGCGAGTGTGGAGGGGACCTGG - Intergenic