ID: 1090366696

View in Genome Browser
Species Human (GRCh38)
Location 11:126212196-126212218
Sequence CATCCTTAGGAGAAGGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090366696_1090366702 0 Left 1090366696 11:126212196-126212218 CCTGTACCCTTCTCCTAAGGATG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1090366702 11:126212219-126212241 ACGGCCCCTTCCCTTATCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 103
1090366696_1090366713 26 Left 1090366696 11:126212196-126212218 CCTGTACCCTTCTCCTAAGGATG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1090366713 11:126212245-126212267 CCAGCACCTATTTCCTACTTAGG 0: 1
1: 0
2: 0
3: 15
4: 124
1090366696_1090366701 -1 Left 1090366696 11:126212196-126212218 CCTGTACCCTTCTCCTAAGGATG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1090366701 11:126212218-126212240 GACGGCCCCTTCCCTTATCCAGG 0: 1
1: 0
2: 0
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090366696 Original CRISPR CATCCTTAGGAGAAGGGTAC AGG (reversed) Intronic
901538077 1:9896151-9896173 CATCCTAAAGACAAGGGTCCTGG - Intronic
902528027 1:17071802-17071824 CATCCTTAGGAGTAGGCTGTAGG - Intronic
903764880 1:25727726-25727748 GATGCTTAGGAGCGGGGTACAGG + Intronic
905862330 1:41359961-41359983 CGTCCTCAGGAGCAAGGTACTGG + Intergenic
906036327 1:42752340-42752362 CAACCTCAGGAGATGGCTACCGG - Exonic
914361922 1:146943364-146943386 CATCCTCAGGAGAATGATAAGGG - Exonic
914489703 1:148143591-148143613 CATCCTCAGGAGAATGATAAGGG + Exonic
916033641 1:160901603-160901625 CCTCCAAAGGAGAAGGGTGCAGG - Intergenic
919923701 1:202181424-202181446 CATCCTGAGGAGCTGGGTGCAGG + Intergenic
922527669 1:226318269-226318291 CTTCCTCAGGAGAAGGTTCCTGG - Intergenic
1071218286 10:83433024-83433046 CAGCCTTTGTAGAAGGGCACTGG - Intergenic
1076297999 10:129402596-129402618 ATTCCTTTGGAGAAGGGTTCGGG + Intergenic
1077222692 11:1424537-1424559 CATCTAAAGGAGAAGGGTCCAGG + Intronic
1079369116 11:19835184-19835206 CATCTTTAGGCCTAGGGTACTGG + Intronic
1080016531 11:27512743-27512765 AATCCTTAGGAGAAGGCTCTGGG + Intergenic
1082760418 11:57121836-57121858 CACCCTGAGGAGAAGGTTATGGG + Intergenic
1083505743 11:63156113-63156135 CACCCTCAGGAGAAGGATACAGG - Intronic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1090366696 11:126212196-126212218 CATCCTTAGGAGAAGGGTACAGG - Intronic
1096240295 12:49956203-49956225 CCTCCTCAGGAGAAGGGGAAGGG + Exonic
1096979827 12:55721939-55721961 CAGCCTGAGGTGAGGGGTACAGG + Exonic
1097150815 12:56978684-56978706 CATCCTGAAGGGAAGGGCACAGG - Intergenic
1097888453 12:64753909-64753931 CATCCTCAGGAAAAGAATACTGG + Intronic
1100592465 12:96042357-96042379 CAGCCTTTGCATAAGGGTACTGG - Intronic
1101228915 12:102719827-102719849 CAGCCTTAAGAGACAGGTACTGG + Intergenic
1102339495 12:112110369-112110391 CATCCTTTGTATAAGGGCACTGG + Intergenic
1107543694 13:41417057-41417079 CCTCCTTACGGGAAGGGGACAGG - Intergenic
1110579235 13:77099441-77099463 CATCCTTAGGGCAACGGTATGGG + Intronic
1110704212 13:78586648-78586670 CATGTTTATGAGAAAGGTACAGG + Intergenic
1113897963 13:113777696-113777718 CCTCCTTAGGACAAGGGACCTGG - Intronic
1117047392 14:51827176-51827198 AATCCCTAGGAGAAGGGCACGGG + Intronic
1118224417 14:63885437-63885459 CATCCTTCAGAGAAGGGAAATGG - Intronic
1121374259 14:93392398-93392420 CATACTTATGGGAAGGGTACAGG + Intronic
1121819064 14:96951323-96951345 CTTCATTTGGAGAAGGGTCCAGG + Intergenic
1126536480 15:49771093-49771115 CATCATTAAGAGAAAGTTACTGG - Intergenic
1127357691 15:58216745-58216767 CATTCTTATAAGAAGGATACAGG - Intronic
1131179981 15:90233195-90233217 AATCTTTAGGAGAGAGGTACTGG - Intronic
1132382216 15:101374190-101374212 CCTCCTCAGGAGAAGGGAGCGGG - Intronic
1132540955 16:509539-509561 CATCCCAAAGAGAAGGGCACAGG - Intronic
1132569922 16:639867-639889 CAGCCTTTGAAGAAGGGCACTGG + Intronic
1132906898 16:2287091-2287113 TCTCCTTAGGAGAAGGGTGATGG - Intronic
1132947675 16:2540911-2540933 CATCCTTAGGGGAAGGTGAGGGG + Intronic
1132968062 16:2670714-2670736 CATCCTTAGGGGAAGGTGAGGGG - Intergenic
1133840938 16:9408662-9408684 TATCCTAAGGAGGAGGGTACTGG + Intergenic
1133854718 16:9538823-9538845 CAGTCGTAGGACAAGGGTACAGG + Intergenic
1138180218 16:54936225-54936247 CTCCCTTAAGAGAAGGGGACTGG - Intergenic
1141177742 16:81731820-81731842 CAGCCTTTGTAGAAGGGCACTGG + Intergenic
1141466222 16:84207438-84207460 CAGCCTTTGCAGAAGGGCACTGG - Intergenic
1141879575 16:86848831-86848853 CATTCCTAGGAGAAGGGCACTGG + Intergenic
1143222619 17:5275313-5275335 CATCCTGGGAAGAAGGGTCCTGG - Intergenic
1146535598 17:33647909-33647931 CCTCCCTGGGAGAAGGGTCCTGG + Intronic
1146768773 17:35548909-35548931 CATCCAAAGGCGAAGGGGACTGG - Exonic
1147464205 17:40598253-40598275 CATCCTCAGGAAAGGGGTTCAGG - Intergenic
1148107907 17:45129053-45129075 CATCTGTAAGAGAAGGCTACTGG + Intronic
1150761848 17:67969328-67969350 CCTCCTTAGTAGCTGGGTACAGG - Intronic
1151185038 17:72357652-72357674 GATCCATAGGATGAGGGTACTGG + Intergenic
1151622397 17:75254208-75254230 CAGCCTGAGGAGAAGGGGAAAGG - Intronic
1151672002 17:75575983-75576005 CATCCAGAGGAGCTGGGTACAGG + Intergenic
1153611238 18:6887378-6887400 CTTCCTCAGGAGAAGGGCAGTGG - Intronic
1163680134 19:18676431-18676453 CCTCCTTACGATAAGGTTACAGG - Intergenic
1164802637 19:31090357-31090379 CATGCTTAGGAAAAGGTTGCTGG - Intergenic
926693411 2:15753585-15753607 CATCCTCAGAAGAAGTGAACTGG + Intergenic
927170502 2:20365446-20365468 CATGCTAAGGACCAGGGTACAGG - Intergenic
929300030 2:40292743-40292765 CATCCTGAGGAAAAGGCTGCTGG + Intronic
931245150 2:60486170-60486192 CATCCTAGGGAGACTGGTACTGG + Intronic
935663186 2:105487595-105487617 CATCCTTGGGAGAAGGTCAGGGG - Intergenic
937204000 2:120224112-120224134 TTTCCTTTGGAAAAGGGTACTGG + Intergenic
937688244 2:124722646-124722668 CATCCATAGGAGTTGGGTAATGG + Intronic
937717714 2:125053278-125053300 CATGCTTAGGAGAATGGTCAGGG + Intergenic
938589887 2:132726371-132726393 CATCCTTAGGGGATGGGGTCAGG - Intronic
939061423 2:137426447-137426469 CATCATTAGCAGTATGGTACAGG + Intronic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
948369515 2:237479526-237479548 CATCCTTGGGAAAAGGGAAAGGG + Intergenic
948385750 2:237579545-237579567 CATCCTTATAAGAAGGGGAGAGG - Intronic
948597217 2:239087796-239087818 CCTCTTTAGGAGAAGGGCCCAGG - Intronic
948639827 2:239368591-239368613 CGTCCTGAGGAGAGGGGCACAGG + Intronic
949024132 2:241757353-241757375 CATCCAGAGAAGAGGGGTACGGG + Intronic
949024149 2:241757430-241757452 CATCCAGAGAAGAGGGGTACGGG + Intronic
949024165 2:241757507-241757529 CATCCAGAGAAGAGGGGTACGGG + Intronic
1173183615 20:40822453-40822475 CCTGCTTAGGAGAAGGGTGTTGG - Intergenic
1175109172 20:56634254-56634276 CATCCTTAGTAGAAGGTCAGTGG + Exonic
1184536608 22:45091902-45091924 CATCCCTGGGAGAGGGGAACCGG + Intergenic
950195168 3:11004469-11004491 CATGCTTTGGAGAAGGGAAGTGG - Intronic
954485838 3:50850698-50850720 CATCCTGAGGAGAAGGAGAGAGG - Intronic
955133245 3:56191093-56191115 CAACCTGAGCAGAAGGGCACAGG + Intronic
955513838 3:59707437-59707459 CTCCCTAAGGAGAAGGGTTCAGG + Intergenic
956897656 3:73679823-73679845 CATACATAGGAGAAAGGTACTGG + Intergenic
958723854 3:97879221-97879243 CATCCTGGGGAAAAGTGTACTGG - Intronic
959436217 3:106317829-106317851 CATCCATAGGAAAAGGGGAGGGG + Intergenic
961430002 3:126874794-126874816 CATCCTTCTGAGCAGGGAACTGG - Intronic
963167521 3:142220616-142220638 CATTCTGAGGAGAAGGGTAGAGG - Intronic
963347657 3:144115034-144115056 CATCCAGAGGAGCAGGATACAGG + Intergenic
965345239 3:167540472-167540494 CATCCCTAGGGGAAGGGGAAGGG + Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
967481484 3:189978435-189978457 GAGCCTTAAGAGAAGGCTACTGG + Intronic
972091859 4:35296705-35296727 CATCATGAGGAAAAGGGTAAGGG + Intergenic
976283024 4:83344085-83344107 CATCCTCAGAAGAAGTGTCCGGG - Intergenic
977753440 4:100636000-100636022 CATCCTGAAGAGAAGGCTACAGG + Intronic
980530970 4:134053636-134053658 TATCCTTAGGAAAAGGGTGGTGG - Intergenic
988392055 5:30647088-30647110 CATCCTTATGGGAAGGATATGGG + Intergenic
989104845 5:37852398-37852420 CTTCCTTCTGAGATGGGTACTGG - Intergenic
990719731 5:58680749-58680771 AATCCTTATAAGAAGGATACCGG - Intronic
992856509 5:80867105-80867127 CATGCTTAGAAGAGGGGTAAGGG - Intronic
993677951 5:90840079-90840101 TATCCTAAGGAGTAGGGTCCTGG - Intronic
997656152 5:135556081-135556103 CATGCTTTGGAGAAGAGTAGGGG + Intergenic
998526175 5:142845296-142845318 CATCCTTAGAAGAATGCTTCCGG + Intronic
999677170 5:154015554-154015576 CATCCTTAGGAAAAGGGGGAAGG + Intronic
1005900743 6:30214417-30214439 TACCCTTAGGAGCAGGGCACTGG - Intergenic
1007788455 6:44295445-44295467 CATCCTCAGGACCAGGGTCCAGG + Intronic
1014981331 6:127949579-127949601 AAACCTTTGGAGAATGGTACTGG - Intergenic
1016685706 6:146880036-146880058 CAGCCTTTGTAGAAGGGTGCTGG - Intergenic
1017943850 6:159077554-159077576 CTTCCTCACTAGAAGGGTACTGG - Intergenic
1019970866 7:4539665-4539687 CAGCCTTTGTATAAGGGTACTGG - Intergenic
1022864039 7:34398735-34398757 CATCCTTTGGTCAAGGGAACAGG + Intergenic
1022960788 7:35424347-35424369 CATCCTTGGGTGGAGGGTAGAGG + Intergenic
1026366727 7:69655796-69655818 CCTGTTTAGGAGAAGGGTCCTGG + Intronic
1029136194 7:98373885-98373907 GAACCTCTGGAGAAGGGTACGGG + Intronic
1033661326 7:143405129-143405151 CTTCCTTAGGAGAAGCCTCCTGG - Intronic
1039066570 8:33613714-33613736 CATCCTTATAAGAAGGAAACAGG - Intergenic
1041456580 8:58066978-58067000 TATCTTAAGGAGAAGGGTCCTGG - Intronic
1041887001 8:62821744-62821766 CCTCCAAAAGAGAAGGGTACAGG - Intronic
1047842477 8:128767688-128767710 CATCCCTAGGGGAAGGGGAAGGG + Intergenic
1049439755 8:142603926-142603948 GACCCTTAGGAGATGGGGACGGG + Intergenic
1051085651 9:13345839-13345861 CCTCCAGAGGAGAAGGGAACTGG - Intergenic
1054928763 9:70615011-70615033 GATCTTTAGGAGAAGCCTACTGG + Intronic
1055609705 9:78009044-78009066 CTGCCTTAGGAGGAGGGTAAAGG + Intronic
1057363676 9:94398775-94398797 CAGCCTTTGCATAAGGGTACTGG + Intronic
1057375194 9:94514846-94514868 CAGCCTTTGTAGAAGGGCACTGG + Intergenic
1057510031 9:95670266-95670288 CCTCCCAAGGAGAAGGGCACCGG - Intergenic
1057659659 9:96989312-96989334 CAGCCTTTGCATAAGGGTACTGG - Intronic
1059927206 9:119221739-119221761 AATCCTTAGGTGAAAGATACAGG + Intronic
1062432592 9:136532718-136532740 CCTCCTTAGGAGATGGGAAGCGG - Intronic
1188913346 X:35878726-35878748 GATCCTCTGGAGAAGGGGACAGG + Intergenic
1194853352 X:98897121-98897143 CATTCTTTGCAGAAGGGTATAGG - Intergenic
1194978436 X:100415726-100415748 CATCCCAAGGAGGAGGGTAAGGG + Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1198414147 X:136402825-136402847 TCACCTTAGGAGAAGGGCACAGG - Intronic