ID: 1090367014

View in Genome Browser
Species Human (GRCh38)
Location 11:126215076-126215098
Sequence TCCCAATGACTGTACTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090367014_1090367016 -9 Left 1090367014 11:126215076-126215098 CCTGGAAAGTACAGTCATTGGGA 0: 1
1: 0
2: 3
3: 5
4: 127
Right 1090367016 11:126215090-126215112 TCATTGGGAGCCAGGAGATGTGG 0: 1
1: 0
2: 1
3: 36
4: 406
1090367014_1090367017 -8 Left 1090367014 11:126215076-126215098 CCTGGAAAGTACAGTCATTGGGA 0: 1
1: 0
2: 3
3: 5
4: 127
Right 1090367017 11:126215091-126215113 CATTGGGAGCCAGGAGATGTGGG 0: 1
1: 0
2: 1
3: 49
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090367014 Original CRISPR TCCCAATGACTGTACTTTCC AGG (reversed) Intronic