ID: 1090369432

View in Genome Browser
Species Human (GRCh38)
Location 11:126238069-126238091
Sequence CCGCACCCGGCCTCTTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090369432_1090369436 7 Left 1090369432 11:126238069-126238091 CCAATGGAAGAGGCCGGGTGCGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1090369436 11:126238099-126238121 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1090369432_1090369441 17 Left 1090369432 11:126238069-126238091 CCAATGGAAGAGGCCGGGTGCGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1090369441 11:126238109-126238131 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1090369432_1090369437 8 Left 1090369432 11:126238069-126238091 CCAATGGAAGAGGCCGGGTGCGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1090369437 11:126238100-126238122 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1090369432_1090369439 11 Left 1090369432 11:126238069-126238091 CCAATGGAAGAGGCCGGGTGCGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1090369439 11:126238103-126238125 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1090369432_1090369443 21 Left 1090369432 11:126238069-126238091 CCAATGGAAGAGGCCGGGTGCGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1090369443 11:126238113-126238135 GCACTTTGGGAGGCCAAGGCAGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
1090369432_1090369444 24 Left 1090369432 11:126238069-126238091 CCAATGGAAGAGGCCGGGTGCGG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1090369444 11:126238116-126238138 CTTTGGGAGGCCAAGGCAGGCGG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090369432 Original CRISPR CCGCACCCGGCCTCTTCCAT TGG (reversed) Intronic
900196464 1:1378690-1378712 TCGCACCTGGCCTCTGCCCTCGG + Intergenic
901294296 1:8148498-8148520 CCGCACCCGGCCCCTATCAGAGG - Intergenic
901809393 1:11758666-11758688 CCGCACCTGGCCTGTTCTTTAGG - Intergenic
902284060 1:15395021-15395043 CCGCACCCAGCCTTTCCCATAGG - Intronic
902468317 1:16631366-16631388 GCTCACCCGGCCTCTGCCCTGGG - Intergenic
902576441 1:17380912-17380934 CCTCACCAGTCCTGTTCCATGGG + Intronic
903064826 1:20693554-20693576 CCGCACCCAGCCTCCACCTTGGG + Intronic
904836217 1:33338832-33338854 CCTCCCCCAGCCTCTCCCATCGG - Intronic
906798153 1:48713703-48713725 CTGCACCTAGCCTCTTCCTTAGG - Intronic
908352663 1:63301436-63301458 CTGCGCCCGGCCTCTACAATAGG + Intergenic
911198917 1:95024265-95024287 CCGCGCCCGGCCTTTTAAATAGG + Intronic
913242118 1:116838235-116838257 CCCCTCCTGGCCTCTTTCATGGG - Intergenic
914946247 1:152069225-152069247 CCCCACCTGGCCTATTCCTTCGG + Intergenic
920515808 1:206584069-206584091 CCACACCCTGCCTCTTACAATGG + Intronic
924224230 1:241907718-241907740 CCGCACCCGGCCTGAACTATTGG - Intergenic
924521044 1:244806432-244806454 CCACACCCGGCCTCTCCTAGTGG - Intergenic
1069683436 10:70301149-70301171 CCCCACCTTGCCTCTTCCCTTGG + Exonic
1076140943 10:128078171-128078193 CTACACCCGCCCTCTCCCATGGG + Intronic
1076360717 10:129887023-129887045 CCCCACCCAGCCTCTTCCCCGGG - Intronic
1077328857 11:1975234-1975256 CCGCATGCGGCCGCATCCATGGG - Intronic
1078328613 11:10400614-10400636 TCGCCCCCTGCCTCTACCATAGG + Intronic
1079014023 11:16853798-16853820 CAGCTCCCGGCCTCTTCTGTTGG - Intronic
1082005705 11:47417968-47417990 GGGCCCCCGGCCTCTTCCAGTGG - Intergenic
1083594091 11:63910839-63910861 GAGCACCCGGGCTGTTCCATAGG - Exonic
1083853824 11:65382375-65382397 CCGCACCCGGCCTCTCTCTGTGG - Intronic
1084018491 11:66402172-66402194 CCGCGCCTGGCCGATTCCATGGG + Intergenic
1086143381 11:83523822-83523844 CCGCCCCCTGCCCCTGCCATTGG - Intronic
1087755030 11:102046537-102046559 CCGCACCCGGCCTGTTTCTATGG - Intergenic
1090369432 11:126238069-126238091 CCGCACCCGGCCTCTTCCATTGG - Intronic
1091293426 11:134455355-134455377 CTGCTCACGGTCTCTTCCATTGG + Intergenic
1202811836 11_KI270721v1_random:30413-30435 CCGCATGCGGCCGCATCCATGGG - Intergenic
1091562228 12:1623483-1623505 CCGCGCCCGGCCTCTTTGAAGGG + Intronic
1092025277 12:5234567-5234589 CCTCACTCAGCCTCTTCCCTCGG + Intergenic
1095882226 12:47150283-47150305 CCGCGCCCGGCCTATTTCTTTGG - Intronic
1102473911 12:113176275-113176297 CAGCACCCGGCCCCTAACATGGG - Intronic
1104457687 12:128928910-128928932 CCGCACCCGGCCTCTTTGTGGGG + Intronic
1105413884 13:20192974-20192996 CCACACCCCGCCTCTTCCCTCGG + Intergenic
1105896100 13:24718497-24718519 CCCCAGCCGGCCTCTTCCCCGGG - Intergenic
1106178002 13:27347638-27347660 CCGCTCCCTGCCTGGTCCATTGG - Intergenic
1113284981 13:108836581-108836603 CTGCACCCGGCTGCTTTCATGGG - Intronic
1115841591 14:37477188-37477210 CTGCACCCGGCCTCTTAACTTGG + Intronic
1118971163 14:70639750-70639772 CTGCACCCGGCCACTTACAATGG + Intergenic
1124259111 15:28171782-28171804 CCGCACCCGGTCTATTGTATAGG - Intronic
1129779989 15:78264101-78264123 CCCCACCCGGCCTCTCCCCGGGG - Exonic
1132163895 15:99566256-99566278 CCGGACACGGCCTCGTCCAGGGG - Intronic
1133479824 16:6159365-6159387 CCGCACACGGCCTCTGTCATAGG + Intronic
1133623111 16:7545290-7545312 CCGCACCCTGCCTCTCTCAGTGG - Intronic
1134168762 16:11951735-11951757 CCGCACCTGGCCTACTCCAGGGG - Intronic
1134440638 16:14297860-14297882 CCGCACCCGGCCTGTACAATAGG - Intergenic
1138652063 16:58466304-58466326 CCGCACCCAGCCCCCACCATGGG + Intronic
1140897683 16:79339347-79339369 CCGCACCCGGCCTGGGTCATGGG + Intergenic
1141087544 16:81107679-81107701 CAGCACGCTGACTCTTCCATGGG + Intergenic
1141644014 16:85357760-85357782 CAGCACCCGGTCTCTCCCCTAGG - Intronic
1144851056 17:18244150-18244172 CCCCACCTGTCCTCTTCCCTAGG - Exonic
1145865840 17:28241006-28241028 CCGCCCCCGACCTCTGCCACTGG - Intergenic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1147474237 17:40694935-40694957 CCGCACCCAGCCTCGCACATGGG - Intergenic
1148129101 17:45252393-45252415 CCACACCCGGCCCGTTCTATGGG - Intergenic
1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG + Intergenic
1151886432 17:76925719-76925741 CCACCCCGGGCCTCTTCCCTGGG + Intronic
1151953955 17:77371520-77371542 CCGGACCCGGCATCTTCCCAGGG + Intronic
1157643531 18:49242988-49243010 CCGCACCCGGCCTATACCTAGGG + Intronic
1160102270 18:75934174-75934196 CCAAACCCAGCCTCCTCCATTGG + Intergenic
1160864055 19:1249475-1249497 CCGCTCCCGGCCGCTCCCTTGGG + Intronic
1161279614 19:3438725-3438747 CCGCACCCGGCCTCCTCCTGAGG + Intronic
1161592887 19:5136687-5136709 CCGCCCCCAGCCTCTTCAGTGGG + Intronic
1163899156 19:20085548-20085570 CCGCGCCCGGCCAGTTGCATTGG + Intronic
1167121106 19:47517299-47517321 CCGCACCCGGCCAATTTCCTTGG - Intergenic
1167414731 19:49364057-49364079 CAGCACCCGGCCTCATCCAATGG - Intronic
1167937114 19:52918197-52918219 CCGCACCCAGCCTCTGCAAGTGG - Intergenic
1168025584 19:53641228-53641250 CTGCACCCAGCCTCCTCCCTGGG + Intergenic
1168314085 19:55476549-55476571 CCGCCCCCGGACCCTCCCATTGG - Exonic
924987972 2:288406-288428 CCGCACCCGGCCTCCTCCGTGGG - Intronic
925153495 2:1633603-1633625 AAGCCCCCGGCCTCTTCCCTGGG - Exonic
925526840 2:4812758-4812780 CCTCTCCCTGCCTCTTCCTTTGG - Intergenic
928568996 2:32584080-32584102 CCGCACCCAGCCTATTCTTTAGG - Intronic
933277987 2:80303343-80303365 TCGCGCCCGACCTCTTCCACGGG - Exonic
935167222 2:100580153-100580175 CTGTACCCGGCCCCTTTCATGGG - Intergenic
938857987 2:135335399-135335421 CAGCGCCCAGCCTCTTCCAATGG - Intronic
940318471 2:152349123-152349145 CCGCGCCCGGCCACTTCTAAGGG + Intronic
941110699 2:161416807-161416829 GCGCACCCCGCCTTCTCCATCGG + Exonic
944743325 2:202633492-202633514 CCACACCCGGCCTCCTCTCTAGG + Intergenic
946250068 2:218406344-218406366 CCGCTCCCCGCCTCTGCCTTCGG - Intergenic
947863989 2:233383329-233383351 CCGCGCCCAGCCCGTTCCATGGG + Intronic
948097026 2:235343569-235343591 CCTCTCCCCGCCTCTTCCCTGGG - Intergenic
948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG + Intronic
1173795115 20:45854497-45854519 CCGCGCCCGGCCTCACACATAGG + Intronic
1174458300 20:50665144-50665166 CCGCACCCGGCCAGCACCATGGG - Intronic
1176422971 21:6531244-6531266 CCGCACCCAGCCTATGACATAGG - Intergenic
1178224023 21:30694279-30694301 CCACACCTGGCCTGTTTCATTGG - Intergenic
1179338480 21:40481197-40481219 CCGCACCCGGCCTGTTCTTGTGG - Intronic
1179698465 21:43139561-43139583 CCGCACCCAGCCTATGACATAGG - Intergenic
1180228699 21:46413380-46413402 CTGCACCCAGCCTCTCCCAGGGG - Intronic
1180593269 22:16958078-16958100 CCGCACCCGGCTCCTTTCCTGGG + Intergenic
1181036305 22:20171419-20171441 CCCCTCCCGGCCTCTACCCTTGG - Intergenic
1182340849 22:29619683-29619705 CCGTGCCCGACCTCTCCCATGGG + Intronic
1183657740 22:39198993-39199015 CCGCGCCCGGCCAATTCCTTGGG - Intergenic
949619207 3:5791036-5791058 TCTCTCCTGGCCTCTTCCATTGG - Intergenic
949875917 3:8626067-8626089 CCCCACACTGCCTCTTCCAAGGG + Intronic
950473210 3:13199255-13199277 CCGCACCTGGCCCCTTCTCTAGG + Intergenic
952793504 3:37218600-37218622 CCACACCCGGCCTGTATCATGGG - Intergenic
953285547 3:41603713-41603735 CTTCACCCAGCCTCTTCCAGTGG - Intronic
953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG + Intronic
955406914 3:58631391-58631413 CAGCACGTTGCCTCTTCCATGGG + Intergenic
955755155 3:62218650-62218672 CCACACAGGGCCTCTTCTATGGG - Intronic
961215418 3:125156152-125156174 CCACACATGGCCTCTCCCATTGG - Intronic
961249900 3:125492898-125492920 CTGGACCCTGCCTCTTCCTTGGG - Intronic
965514036 3:169601460-169601482 ACTCACCAGGCCTCTTACATGGG + Intronic
966993092 3:185254082-185254104 GCGCGCCCGGCCTCCTCCAGAGG + Exonic
967055695 3:185826353-185826375 CCCAACCCTGCCTCTTCCGTCGG - Intergenic
968699202 4:2046829-2046851 CCCTACCCCGCATCTTCCATGGG - Intergenic
969702170 4:8773687-8773709 CGGCACACGCCCTCTTCCCTGGG - Intergenic
970397126 4:15680378-15680400 CTGCACCCAGCCTCTCCCACTGG - Intronic
972446633 4:39150577-39150599 CCGCACCCGGCCTTTACCTGTGG - Intergenic
973360262 4:49158725-49158747 CTGCGCCCGGCCTCTACCCTAGG + Intergenic
973399824 4:49629184-49629206 CTGCGCCCGGCCTCTACCCTAGG - Intergenic
975339158 4:73218352-73218374 CTGCAGCCGGCCTCTGCCATTGG - Intronic
980153357 4:129076095-129076117 CAGCACCCTGCTTCTTTCATAGG + Intronic
980680592 4:136155102-136155124 CCGCACCTGGGCACCTCCATGGG - Intergenic
986672670 5:10156907-10156929 GCCCACCCGGCCACTTTCATGGG + Intergenic
987123181 5:14787021-14787043 CCGCACCCGGCCTGTTTCTTGGG - Intronic
992803223 5:80311908-80311930 CCGCACCTGGCCTGTTTAATAGG + Intergenic
1001087395 5:168710768-168710790 CTTCACCCTGTCTCTTCCATGGG - Intronic
1001712396 5:173789254-173789276 CCTCACCCCAGCTCTTCCATTGG + Intergenic
1002953514 6:1839759-1839781 GCACACCCTGCCCCTTCCATGGG - Intronic
1003876859 6:10445497-10445519 CCACACCCGGCCTCTTTTATAGG + Intergenic
1005840087 6:29738664-29738686 CCCTGCCAGGCCTCTTCCATGGG - Intergenic
1005854271 6:29848675-29848697 CCCTGCCAGGCCTCTTCCATGGG - Intergenic
1006636970 6:35468142-35468164 CCGAACCCAGCCGCTTCCCTAGG + Intergenic
1007111019 6:39313622-39313644 CCACACCTGGCCGCTTCCAGAGG - Intronic
1007807259 6:44459603-44459625 CCGCACCTGGCCTCTTGTATTGG + Intergenic
1008591019 6:52994193-52994215 CTCCATCCGGCCTCTTCCGTTGG + Exonic
1011041209 6:83032213-83032235 CCCCACCCAGCTTCTTTCATGGG - Intronic
1013013015 6:106136532-106136554 CCGCACCCGGCCTGACCCACAGG - Intergenic
1015339711 6:132084450-132084472 CCGCACCCGGCCTCCTCAGCTGG - Intergenic
1015402129 6:132798642-132798664 CCGCCCCCGGCCTCCTCCCGGGG - Intergenic
1015570529 6:134617130-134617152 CAGCGCCAGGCCTGTTCCATTGG - Intergenic
1015923795 6:138290668-138290690 CAGCCCCCGCCCTGTTCCATGGG - Intronic
1016687241 6:146895477-146895499 CCATACCCGGCCCCTTTCATAGG - Intergenic
1019279814 7:193895-193917 CCCTGCCCGGCCTCTTCCATGGG - Intronic
1019471912 7:1225554-1225576 CCTCTCCCGGCCTCCACCATCGG + Intergenic
1021412083 7:20340355-20340377 CCAAACTCGGTCTCTTCCATAGG - Intronic
1022459388 7:30590566-30590588 CCGCGCCCGGCCGATTCCTTAGG - Intergenic
1023190477 7:37575550-37575572 TCGCACCTGGCCTTTTCCATTGG - Intergenic
1025007132 7:55363576-55363598 CCGCACCCGGCGGCTTCCCCAGG + Intergenic
1027676522 7:81165285-81165307 TGGCACCCTGCCTCTTCCCTGGG + Intergenic
1033209163 7:139447691-139447713 CCGCACCCAGCCTTTTGAATTGG + Intergenic
1033282214 7:140014360-140014382 ACAGACCCGGCCTCTTCCCTGGG - Intronic
1034106340 7:148494013-148494035 CCACACCCGGCCTCCTCCAAGGG + Intergenic
1034428718 7:151029031-151029053 CCGCGCCCGGCCTATTAGATTGG - Intronic
1035679668 8:1478687-1478709 CCGGACCAGGTCTATTCCATTGG - Intergenic
1038612220 8:29068009-29068031 CCCCACCCCGCCACTTCCCTCGG - Exonic
1040363122 8:46686293-46686315 CCACACCTGGCCTCTCCTATGGG + Intergenic
1040388201 8:46928300-46928322 CCTCATCTGGCCTCTGCCATTGG + Intergenic
1042235847 8:66612945-66612967 CCGCACTCGGCCGCCTCCAGAGG - Exonic
1049439723 8:142603794-142603816 CCCCACCCTGCCTCTTCCCAAGG - Intergenic
1049792999 8:144481177-144481199 CCGCGCCCGGCCTGTTTGATGGG + Intronic
1051734883 9:20188065-20188087 CCCCACCTGGCCTCTTGGATTGG + Intergenic
1052386349 9:27827723-27827745 CCGCATCCAGCCTCTTTTATAGG + Intergenic
1055898130 9:81203310-81203332 CAGCCCCCAGCCTCTTCCTTTGG + Intergenic
1057824196 9:98359751-98359773 CCACGGCCGGCATCTTCCATGGG - Intronic
1060523929 9:124309947-124309969 CCGCCACCGGCCTCTTCAAAAGG - Intronic
1061100384 9:128487495-128487517 CCGCACCCGGCCAATTACACAGG - Intronic
1061108966 9:128553094-128553116 CCGCCCCCGGTCCCTTCCCTCGG + Intronic
1062105885 9:134754530-134754552 GCGGACCAGGCCTCTTCCCTGGG + Intronic
1062437694 9:136553915-136553937 CAGGACCCTGCCTCTCCCATTGG + Intergenic
1062635260 9:137487250-137487272 CCGCACCCAGCTTCTGCCAAGGG + Intronic
1185895783 X:3857770-3857792 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1185900902 X:3896194-3896216 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1185906017 X:3934633-3934655 CCGCGCCCGGCCTCCTTCAAGGG - Intergenic
1190156237 X:47995039-47995061 CCGCGCCCGGCCTCTTCTGCTGG - Intronic
1194844972 X:98794232-98794254 ACACACTCGGCCTGTTCCATTGG + Intergenic
1196534420 X:116825163-116825185 CCCCTCCCCTCCTCTTCCATTGG - Intergenic
1197208885 X:123813323-123813345 CCGCACCCGGCCTCTCCAGCTGG - Intergenic