ID: 1090371224

View in Genome Browser
Species Human (GRCh38)
Location 11:126254495-126254517
Sequence ATGTTCCCCTTTAAGATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090371224_1090371226 5 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371226 11:126254523-126254545 TTTCATTAAGTGAAAACGGAAGG 0: 1
1: 0
2: 0
3: 22
4: 215
1090371224_1090371231 25 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371231 11:126254543-126254565 AGGTCAGGGGCTAGGAGCAGTGG 0: 1
1: 0
2: 4
3: 90
4: 771
1090371224_1090371228 11 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371228 11:126254529-126254551 TAAGTGAAAACGGAAGGTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 163
1090371224_1090371229 12 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371229 11:126254530-126254552 AAGTGAAAACGGAAGGTCAGGGG 0: 1
1: 0
2: 3
3: 16
4: 299
1090371224_1090371227 10 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371227 11:126254528-126254550 TTAAGTGAAAACGGAAGGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 129
1090371224_1090371230 17 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371230 11:126254535-126254557 AAAACGGAAGGTCAGGGGCTAGG 0: 1
1: 0
2: 2
3: 18
4: 240
1090371224_1090371225 1 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371225 11:126254519-126254541 TTCTTTTCATTAAGTGAAAACGG 0: 1
1: 0
2: 8
3: 158
4: 1146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090371224 Original CRISPR ATGTTCCCCTTTAAGATCTA TGG (reversed) Intronic
904909875 1:33926797-33926819 ATGATCGACTTTAAGTTCTACGG + Intronic
906057312 1:42927327-42927349 ATGTTCCCTTTTCAGCTCAAAGG - Intronic
907227866 1:52966364-52966386 ATGTTCCCCACTTAGATCTATGG + Intronic
909763137 1:79319477-79319499 ATGTTACCATTCAAGATCAAAGG - Intergenic
911927291 1:103851031-103851053 ATATTACCCTTTAAGTTCTAGGG + Intergenic
912263115 1:108128876-108128898 ATGTTCCCCCTTAAGATATAGGG - Intergenic
912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG + Intergenic
913749796 1:121950427-121950449 AATTTCCCTTTTCAGATCTACGG + Intergenic
916156136 1:161850577-161850599 ATCTTCCCCATTAAGGTCTTTGG + Intronic
918838596 1:189503959-189503981 ATTTTCTCCTTTAAGCTCAATGG - Intergenic
919042279 1:192405332-192405354 CTGTGACCCTTTAAGATCCAAGG - Intergenic
920080718 1:203371107-203371129 TTGTTTCCCTTTCAGATTTAGGG + Intergenic
921363869 1:214355728-214355750 ATATTCCCCATTAAGTTCTTCGG - Exonic
922382806 1:225049647-225049669 ATTTTCTCCTTGAAGATTTATGG + Intronic
1064828960 10:19440356-19440378 ATATTACACTTTAAGTTCTAGGG + Intronic
1064868107 10:19905101-19905123 CTGTTTCCCATTAAGATTTAGGG - Intronic
1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG + Intergenic
1067927409 10:50524089-50524111 ATGCTCACTTTTAAGATCTAGGG - Intronic
1070771240 10:79083570-79083592 ATGTGTCCCTCTAAGATCTCTGG + Intronic
1072031512 10:91526472-91526494 ATGTTCCCGTTAAAGATCAAAGG + Intergenic
1077005104 11:351313-351335 AGGGTCCCTTTTAAGATTTAGGG - Intergenic
1078110832 11:8390470-8390492 ATGTGCCTCTTTAAGGTCTGGGG - Intergenic
1078295820 11:10069175-10069197 ATATTCTACTTTAAGTTCTAGGG + Intronic
1078324882 11:10371388-10371410 ATGTTCTCCTTTAATAACTTAGG - Intronic
1081273712 11:41120667-41120689 CCTTTCCCCTTTCAGATCTAAGG + Intronic
1082612408 11:55317183-55317205 ATGTACCTATTTAAGATCCAAGG - Intergenic
1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG + Intronic
1087924647 11:103905258-103905280 AAGTTCCCTTTTAAGAACTAAGG - Intergenic
1088411980 11:109544287-109544309 AAATTACCCTTTAAGTTCTAGGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1091158515 11:133397250-133397272 ATGTTTCCCTTCAATACCTAGGG + Intronic
1091304245 11:134527330-134527352 ATGCTCCCCTTTAAAATCACAGG - Intergenic
1093390569 12:18614618-18614640 ATCTTCACATTTAAGAGCTAAGG - Intronic
1101655685 12:106718022-106718044 ATGTGCACTTTTAAAATCTAAGG - Intronic
1106243348 13:27927178-27927200 AAGTTCCCCTTTCTGATCCAAGG - Intergenic
1110267174 13:73551754-73551776 AAGTTTCCCCTTAAGAACTATGG - Intergenic
1112239210 13:97664377-97664399 ATGCTCCCCCTTAAGATGTAAGG + Intergenic
1116373815 14:44171734-44171756 ATGTTATGCTTTAAGTTCTAGGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1122472473 14:101980007-101980029 ATGTTACTCTTTAATATCTTTGG + Intronic
1124351697 15:28960601-28960623 AGGTTCCCCTTTAGGAACTGAGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1130843792 15:87725620-87725642 TTGGACCCCTTTAAGATCTGAGG - Intergenic
1131021201 15:89100561-89100583 AGGTTCCTTTTTAACATCTAAGG - Intronic
1131726561 15:95232501-95232523 ATCTTCCTTTTTAATATCTAGGG - Intergenic
1133845507 16:9449941-9449963 ATGTTCACCATTTAGATTTACGG + Intergenic
1134890054 16:17832982-17833004 ATGTTCCTCTTTAGCATGTATGG - Intergenic
1135949855 16:26903846-26903868 ATTTTACCCTTTAAGTTCTCTGG + Intergenic
1137776803 16:51062062-51062084 ATATTAACCTTTGAGATCTAGGG - Intergenic
1138175639 16:54895916-54895938 ATGTTTGCCTTTAATGTCTACGG + Intergenic
1138366113 16:56479089-56479111 ATGTTCACCTGTAAAATATATGG + Exonic
1139229803 16:65272744-65272766 CTGTACCCCTTTGAGCTCTAGGG - Intergenic
1140019951 16:71229285-71229307 TTATTCTCCTTTAAGTTCTAGGG - Intronic
1147546629 17:41406944-41406966 ATATACCCCTTTAAGCACTAAGG - Intergenic
1158825943 18:61219408-61219430 ATCTTTCCCTATAAGATGTATGG + Intergenic
1159494593 18:69185748-69185770 ATATTCCCATTTAAAATATAAGG + Intergenic
1160036888 18:75309902-75309924 ATTTTCTCCTTTGATATCTACGG + Intergenic
1162907857 19:13834027-13834049 ATGTCCCCCCTTAAGAACTGGGG + Intergenic
1164876146 19:31691757-31691779 ATGTTCACCTTTAAACTCAAGGG + Intergenic
928443992 2:31316957-31316979 ATGTTTCCTATTAAGATCTAAGG + Intergenic
929160085 2:38822928-38822950 ATGGTCCCCTTAGAGACCTATGG + Intronic
933239766 2:79907152-79907174 ATGTTCTGCTTTAAGATTTCAGG - Intronic
933384936 2:81597930-81597952 ATGTTCCCCATCAAGAACTGTGG - Intergenic
935220402 2:101007411-101007433 AAGTTCACTTTCAAGATCTAAGG - Intronic
941248025 2:163125089-163125111 TTGTTACACTTTAAGTTCTAGGG - Intergenic
941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG + Intergenic
942658001 2:178234713-178234735 ATTTTTCCTTTTATGATCTAGGG + Intronic
943498594 2:188656455-188656477 TTGTTCACTTTGAAGATCTAAGG - Intergenic
944276435 2:197843740-197843762 TCCTTCCCCTTTCAGATCTAGGG - Intronic
946530112 2:220561556-220561578 ATATTACACTTTAAGTTCTAGGG - Intergenic
946668034 2:222071669-222071691 TTGTTCCCCTTTTATATTTAAGG + Intergenic
946943709 2:224797525-224797547 ATGCACCCCTTTAAGTTCAAGGG + Intronic
947358078 2:229317820-229317842 AGCTTCACCTTTAAGATCAATGG - Intergenic
1171371897 20:24667824-24667846 ATGATCCACTTTAAGTTCAAAGG + Intergenic
1174699428 20:52592746-52592768 ATTTTCTCCTCAAAGATCTAAGG + Intergenic
1177270786 21:18847511-18847533 TTGTTTCCCCTTAAGATATATGG + Intergenic
1178435942 21:32558576-32558598 AGGGTCCCTTTTAAGATTTAAGG - Intergenic
1184675745 22:46042089-46042111 ATGTTCACCTTTAAGAGACAGGG - Intergenic
951141744 3:19170009-19170031 ATGTTCCCATTTGAGATCTGTGG + Intronic
954283612 3:49602169-49602191 ATGTTCCTCTTTCTGATCCAAGG - Intronic
955013035 3:55038257-55038279 ATGTTCACCTTAATAATCTAAGG - Intronic
955864698 3:63371005-63371027 ATGTTCCAGTTAAAGGTCTAGGG - Intronic
956101072 3:65768883-65768905 ATTTTCCCCTTTAAACTCCAGGG + Intronic
956250110 3:67226762-67226784 ATCTTCCCAGTTAAGGTCTATGG + Intergenic
956316612 3:67944691-67944713 ATTTTTCCTTTTAAGAGCTAAGG + Intergenic
956849592 3:73216801-73216823 ATGTTCTCCTTCCAGATCTCCGG - Intergenic
962921363 3:139953384-139953406 ATGTTCCCCCTGAACCTCTAGGG + Intronic
963126886 3:141824636-141824658 TTTTTCCCTTTTAAGATTTATGG - Intergenic
963367856 3:144362044-144362066 ATTTTCCCATTTAAATTCTAAGG - Intergenic
966735640 3:183184840-183184862 ATTTGCCCATTTAATATCTATGG - Intronic
967526308 3:190497858-190497880 ATGTCTTCCTTTAAGAACTAGGG - Intergenic
969552221 4:7878132-7878154 GTCTTTCCCCTTAAGATCTAAGG + Intronic
970542491 4:17094028-17094050 ATGTTGCCCTTTCAGTTTTAGGG - Intergenic
972653827 4:41047234-41047256 CTGTTCTCCTATAAGGTCTAAGG + Intronic
975134217 4:70858431-70858453 ATGTTCACCTCTAAGAATTAAGG - Intergenic
975717350 4:77217641-77217663 TTGTTCCCCTTTGGGATCCAAGG - Intronic
980159533 4:129143127-129143149 ATGTTCCCCTTTCATCTATAAGG - Intergenic
980486302 4:133461661-133461683 ATGGTCCACTTTAATATCTGAGG + Intergenic
981361801 4:143854684-143854706 AAGTTCCCCTTTAAAAGCTCTGG - Intergenic
981372533 4:143975587-143975609 AAGTTCCCCTTTAAAAGCTCTGG - Intergenic
981381627 4:144078789-144078811 AAGTTCCCCTTTAAAAGCTCTGG - Intergenic
987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG + Intronic
988853348 5:35200766-35200788 ATCTTCCCCTGTAAGATATCAGG + Intronic
991944547 5:71887233-71887255 ATTTTCCACATTAAGATCAAAGG + Intergenic
993485621 5:88480601-88480623 ATGTTTGCCTTTAAGATTTTAGG - Intergenic
995270297 5:110212879-110212901 TTGTTACACTTTAAGTTCTAGGG + Intergenic
995690106 5:114816261-114816283 ATGTTATACTTTAAGTTCTAGGG + Intergenic
996419876 5:123250942-123250964 GTGTTACACTTTAAGTTCTAGGG + Intergenic
996558906 5:124807777-124807799 ATGTCCTAATTTAAGATCTATGG + Intergenic
999062064 5:148646638-148646660 ATGGGCCCCTCTAAAATCTATGG - Intronic
999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG + Exonic
1003028662 6:2581009-2581031 ATGTACCCCATTAAGTTGTAAGG + Intergenic
1011242961 6:85291635-85291657 AGGTTCGTCTTTAAAATCTAGGG + Intergenic
1018401684 6:163428090-163428112 ATGTTCTCCTTTAAATTGTAAGG + Intronic
1020158192 7:5745085-5745107 ATCTCCACCTGTAAGATCTACGG + Intronic
1021414464 7:20366155-20366177 ATGTTCCTTTCTAACATCTATGG + Intronic
1022594808 7:31703074-31703096 ATGGTCCCCTTTTAGATTTATGG - Intronic
1027956812 7:84888488-84888510 ATGTTGCCATTCAAGATATAAGG - Intergenic
1028979187 7:96948087-96948109 ATTTTGCCTTTTAAGATCTCAGG + Intergenic
1030794512 7:113770726-113770748 ATGGTACCCTTTAAGTTATACGG - Intergenic
1041742860 8:61175743-61175765 ATGTTCCCTCTTAGGGTCTAGGG - Intronic
1044914291 8:97095811-97095833 ATGTCTCCCTTTAGTATCTAAGG + Intronic
1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG + Intronic
1050605417 9:7296122-7296144 ATGTGCCCCTTTAACATTTGAGG + Intergenic
1053244819 9:36526197-36526219 ATGTTCCCCTGTAAGTGATAGGG + Intergenic
1054439954 9:65251668-65251690 ATGGGTCTCTTTAAGATCTAGGG + Intergenic
1055086132 9:72315837-72315859 ATGTTCCCCTTTGATTTCTGTGG - Intergenic
1056769855 9:89469122-89469144 ATGTTCCTTTTTAATGTCTATGG - Intronic
1188136447 X:26499654-26499676 GTGTTCCCCTTCAAGCTTTAGGG + Intergenic
1189174115 X:38937014-38937036 ACTTTCTCCTTAAAGATCTAAGG - Intergenic
1191697327 X:64003528-64003550 ATGTTCCCCTTTCTGACCTATGG - Intergenic
1193225799 X:78982615-78982637 TTTTTCTCTTTTAAGATCTAGGG - Intergenic
1197868103 X:131039666-131039688 CTTTAACCCTTTAAGATCTAGGG + Intergenic
1198051213 X:132955416-132955438 ATGTTCCCCTTAAATCTCAATGG + Intronic