ID: 1090371225

View in Genome Browser
Species Human (GRCh38)
Location 11:126254519-126254541
Sequence TTCTTTTCATTAAGTGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1313
Summary {0: 1, 1: 0, 2: 8, 3: 158, 4: 1146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090371220_1090371225 24 Left 1090371220 11:126254472-126254494 CCTGGGAAATCTCTCTAAATATG 0: 1
1: 0
2: 0
3: 20
4: 165
Right 1090371225 11:126254519-126254541 TTCTTTTCATTAAGTGAAAACGG 0: 1
1: 0
2: 8
3: 158
4: 1146
1090371219_1090371225 28 Left 1090371219 11:126254468-126254490 CCTTCCTGGGAAATCTCTCTAAA 0: 1
1: 0
2: 1
3: 19
4: 255
Right 1090371225 11:126254519-126254541 TTCTTTTCATTAAGTGAAAACGG 0: 1
1: 0
2: 8
3: 158
4: 1146
1090371224_1090371225 1 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371225 11:126254519-126254541 TTCTTTTCATTAAGTGAAAACGG 0: 1
1: 0
2: 8
3: 158
4: 1146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090371225 Original CRISPR TTCTTTTCATTAAGTGAAAA CGG Intronic
900377430 1:2362253-2362275 TACTATTCATTAAGTGGAAGTGG + Intronic
900382698 1:2392618-2392640 TACTCTTCATAAAGGGAAAAGGG - Intronic
900811533 1:4805335-4805357 TACTATTCATTAGGTGAAAGTGG - Intergenic
900916141 1:5640011-5640033 TCCTTTACATTAATTTAAAATGG - Intergenic
902119163 1:14147027-14147049 TACTATTCATTAAATGGAAATGG - Intergenic
902170396 1:14605618-14605640 TGCTATTCATTAAGTGGAAGTGG + Intronic
902568207 1:17329526-17329548 TACTGTTCATTAAGTGGAAGTGG + Intronic
903765458 1:25731406-25731428 TTGTTTTCCTTAAATGTAAATGG - Intronic
904713005 1:32445196-32445218 TGCTGTTCCTTCAGTGAAAAGGG - Intergenic
904801492 1:33096185-33096207 TACTATTCATTAAGTGGAAGTGG + Intronic
904878796 1:33678505-33678527 ATCTTTACATTAGGGGAAAATGG + Intronic
904936184 1:34131365-34131387 TTCTTTTCAATAAGCAAACAGGG + Intronic
904953593 1:34264294-34264316 TACTATTCATTAAGTGGAAGTGG - Intergenic
905163415 1:36058139-36058161 TTCATTTTAGTAAATGAAAATGG - Exonic
905680440 1:39867097-39867119 CTCTTCTCTTTAAGGGAAAAGGG + Intronic
905935592 1:41821642-41821664 TTCTTTCCAATATGTAAAAAGGG - Intronic
906169402 1:43711299-43711321 ATCTTTTCATTTAATCAAAATGG - Intronic
906550317 1:46660432-46660454 TTTATTTCTATAAGTGAAAATGG - Intronic
906731760 1:48088798-48088820 TTCTTTTCAATGTGTTAAAATGG + Intergenic
906789055 1:48642771-48642793 TTCCGTTTCTTAAGTGAAAAAGG + Intronic
906840800 1:49136942-49136964 TCATTTTTATTAAGTGGAAAGGG - Intronic
906994617 1:50778610-50778632 TACTATTCATTAAGTGAAAGTGG + Intronic
907124369 1:52036377-52036399 TAGTATTCATTAAGTGGAAATGG + Intronic
907610097 1:55860551-55860573 TTGTTTGCTTAAAGTGAAAAGGG + Intergenic
907878737 1:58522824-58522846 TACTATTCATTAAGTGGAAGTGG + Intronic
907921113 1:58912747-58912769 TACTATTCATTAAGTGGAAGTGG - Intergenic
908060116 1:60338792-60338814 TTGTTCTCATTTTGTGAAAAGGG + Intergenic
908216934 1:61963637-61963659 TACTATTCATTAAGTGGAAGTGG + Intronic
908264596 1:62365852-62365874 TACTATTCATTAAGTGGAAGTGG + Intergenic
908275932 1:62471047-62471069 TACTCTTCATTAAGTGGAAGTGG - Intronic
908285522 1:62594561-62594583 TTACTTTCATTAACTAAAAAAGG + Intronic
908304317 1:62795823-62795845 TTTTTTTTTTTAAGTAAAAAGGG - Intronic
908379689 1:63584702-63584724 TACTGTTCATTAAGTGAAAGTGG - Intronic
908569844 1:65397806-65397828 TTCCCATCATTAAGTTAAAAAGG - Intronic
908579604 1:65500560-65500582 TACTATTCATTAAGTGGAAATGG - Intronic
908660446 1:66429403-66429425 TTCTTTTAATTGAATGATAATGG - Intergenic
908750629 1:67419196-67419218 TACTGTTCATTAAGTGGAACTGG - Intronic
908860091 1:68474846-68474868 ATCTTTTCATTATGAGACAAAGG - Exonic
908963033 1:69725188-69725210 TACTGTTCATTAAGTCAAAGTGG + Intronic
909142548 1:71887165-71887187 TACTCTTCATTAAGTGGAAGTGG + Intronic
909361150 1:74760133-74760155 TATTATTCATTAAGTGGAAATGG + Intronic
909608526 1:77530830-77530852 TTCTTCTGATTAAGTCAGAATGG - Intronic
909614156 1:77587891-77587913 TACTATTCATTAAGTGAAAGTGG - Intronic
909967865 1:81940105-81940127 TGCTTTCCATTCATTGAAAATGG - Intronic
910059651 1:83074219-83074241 TTATATTCAATAAGTGAAATAGG + Intergenic
910073931 1:83254087-83254109 TTCATTACATTAAGTGTAAATGG - Intergenic
910173527 1:84403451-84403473 CACTCTTCATTAAGTGGAAATGG + Intronic
910274813 1:85437495-85437517 TACTGTTCATTAAGTGGAAGTGG - Intronic
910327872 1:86030604-86030626 TGCTTTGCAAGAAGTGAAAAGGG + Intronic
910411321 1:86948533-86948555 TTCTGGTCATTAAGTAAAAGAGG - Intronic
910457871 1:87417273-87417295 TACTATTCATTAAGTGGAAGTGG + Intergenic
910484478 1:87697739-87697761 TACTATTCATTAAGTGGAAGTGG - Intergenic
910868103 1:91806226-91806248 TTTTTTTCTTTAAGTGGAACTGG - Intronic
910892075 1:92028939-92028961 TACTATTCATTAAGTGGAAGTGG - Intergenic
911441479 1:97932213-97932235 AAATTTTCAATAAGTGAAAATGG + Intergenic
911572925 1:99539656-99539678 TACTGTTCATTAAGTGGAAGTGG + Intergenic
911719293 1:101172733-101172755 TACTATTCATTAAGTGGAAGTGG - Intergenic
911757687 1:101579038-101579060 TTCTTTTCAATAACCGAAATGGG + Intergenic
911836358 1:102624140-102624162 TACTATTCATTAAGTGGAAGTGG - Intergenic
911951136 1:104174651-104174673 TTCTTTACATTAAAAGATAAAGG + Intergenic
912063848 1:105709948-105709970 TTCTTTCCAAGATGTGAAAATGG + Intergenic
912882908 1:113436559-113436581 TTTTTTTCATTTAATTAAAATGG + Intronic
913287425 1:117239514-117239536 TTCTATCCATTAAGTGATAATGG + Intergenic
913320398 1:117584070-117584092 TACTATTCATTAAGTGGAAGTGG + Intergenic
914315138 1:146503750-146503772 TACTATTCATTAAGTGGAAGTGG + Intergenic
914416537 1:147488529-147488551 TTGTGGTCATTAATTGAAAATGG + Intergenic
914499216 1:148229626-148229648 TACTATTCATTAAGTGGAAGTGG - Intergenic
915480447 1:156180967-156180989 AACTATTCATTAAGTGGAAATGG + Intergenic
916025038 1:160826189-160826211 TACTATTCATTAAGTGGAATTGG + Intronic
916264533 1:162877344-162877366 TTCTTTTCTTTAATTACAAATGG - Intergenic
916704812 1:167338239-167338261 TACTATTCATTAAGTGGAAGTGG - Intronic
917071616 1:171157593-171157615 TACTATTCATTAAGTGGAAGTGG - Intronic
918033244 1:180838240-180838262 TCCTGTTCATTAAGTGGAAGTGG + Intronic
918061748 1:181067512-181067534 TTCTTTTTGTTAAGAGACAAAGG - Intergenic
918166183 1:181949675-181949697 TTCCTGCCATCAAGTGAAAAAGG + Intergenic
918629251 1:186695869-186695891 TACTATTTATTAAGTGACAATGG - Intergenic
919029512 1:192222596-192222618 TACTATTTATTAAGTGAAAGTGG - Intergenic
919037253 1:192329483-192329505 TGCTTATTATTAAGAGAAAAGGG + Intronic
919086397 1:192925609-192925631 TACTATTCATTAAGTGGAAGTGG + Intergenic
919123811 1:193372833-193372855 TTGTTTTCATCAAGGTAAAACGG + Intergenic
919191980 1:194232133-194232155 TACTCTTCATTAAGTGGAGATGG + Intergenic
919314684 1:195956080-195956102 TACTGTTCATTAAGTGGAAGTGG + Intergenic
919384368 1:196900461-196900483 TTCTTTTCAAAAAATCAAAAAGG - Intronic
919473067 1:198002731-198002753 TTTTTTTCATAACCTGAAAAAGG + Intergenic
919538344 1:198816309-198816331 TACTATTCATTAAGTGGAAGTGG - Intergenic
919937989 1:202267456-202267478 TTCTTTTCATTAAATGGGACAGG + Intronic
920008252 1:202849220-202849242 TACTGTTCGTTAAGTGGAAATGG - Intergenic
920277319 1:204816159-204816181 TACTATTCATTAAGTGGAAGTGG + Intergenic
920391493 1:205605972-205605994 TTCATTTTATTAAATGAAACAGG - Intronic
920413484 1:205781312-205781334 TACTATTCATTAAGTGGAAGTGG + Intergenic
920631495 1:207657242-207657264 CTCTCTCCAATAAGTGAAAATGG - Intronic
920641981 1:207761368-207761390 CTCTCTCCAATAAGTGAAAATGG - Exonic
920750337 1:208668902-208668924 TTCTTGTCATCAGGTGGAAATGG - Intergenic
920894156 1:210027453-210027475 TACTGTTCATTAAGTGGACATGG + Intronic
921005811 1:211092707-211092729 TTCTGTTGCTTAATTGAAAATGG - Intronic
921194915 1:212746536-212746558 TCCTTATCAGTAAGTGTAAATGG + Intronic
921299733 1:213739197-213739219 TACTATTCATTAAGTGAAAATGG - Intergenic
921458157 1:215396512-215396534 TACTATTCATTAAGTGGAAGTGG + Intergenic
921494250 1:215817989-215818011 TACTATTCATTAAGTGGAAGTGG - Intronic
921498853 1:215875258-215875280 TTCTTAACATTCAGTGTAAATGG - Intronic
921572157 1:216792895-216792917 TTCTTTTCACTAAGGGATCATGG - Intronic
921768467 1:219003494-219003516 TACTATTCATTAAGTGGAAGTGG + Intergenic
921801688 1:219409898-219409920 TTCCTCTCATAAAGTGAAAATGG - Intergenic
921960826 1:221032672-221032694 TTCTTCTTATTAAGAAAAAAAGG + Intergenic
922001382 1:221481939-221481961 TACTATTCATTAAGTGGAAGTGG - Intergenic
922002344 1:221492259-221492281 TACTATTCATTAAGTGGAAGTGG + Intergenic
923006356 1:230053181-230053203 TCCTATTCATTAATTGGAAATGG + Intergenic
923054077 1:230412351-230412373 TTCTATTCATTAAGGGGAAATGG + Intronic
923161298 1:231317049-231317071 TCCTATTCATTAAGTGGAAGTGG - Intergenic
923199806 1:231700324-231700346 TCCTATTCATTAAGTGAAAGTGG - Intronic
923218172 1:231869403-231869425 CGCTATTCATTAAGTGGAAATGG - Intronic
923266754 1:232321747-232321769 TCCTATTCATTAAGTGGAAGTGG - Intergenic
923315358 1:232774526-232774548 TTACTTTCATTAAGTGGAAGTGG - Intergenic
923330388 1:232918355-232918377 TACTATTGATTAAGTGGAAATGG + Intergenic
923355125 1:233147390-233147412 TCCTATTCATTAAGTGGAAGTGG + Intronic
923615514 1:235533984-235534006 TACTATTCATTAAGTGAAAGTGG - Intergenic
923695812 1:236249955-236249977 TTCTTTGCAGTACTTGAAAATGG - Exonic
923705797 1:236343781-236343803 TTCATGGCATTAAGTGAAAAGGG - Intergenic
923754416 1:236777628-236777650 TCCTATTCATTAAATGAAACTGG - Intergenic
923840657 1:237667839-237667861 ATCGTTTCAATAAGTAAAAAAGG - Intronic
923861425 1:237895702-237895724 TCCTATTCATTAAGTGGAAGTGG + Intergenic
924258484 1:242205864-242205886 TTCTTTTAATTGAAAGAAAAAGG + Intronic
924258554 1:242206674-242206696 TACTATTCATTAAGTGGAAGTGG + Intronic
924360931 1:243241029-243241051 TTGTTTTCATAGTGTGAAAATGG - Intronic
924400823 1:243679070-243679092 TGCTATTCATTAAGTGGAAGTGG - Intronic
1063179714 10:3586791-3586813 TTCTTTTCCCTAAGAAAAAAAGG - Intergenic
1064182691 10:13132916-13132938 TTTTTTTTATTAAAGGAAAAAGG + Intronic
1064805903 10:19132180-19132202 TTATTTTCATAAAATGAAAACGG + Intronic
1064911473 10:20406299-20406321 TACTTTTCTTTGAGAGAAAATGG - Intergenic
1064963749 10:20994798-20994820 TACTATTCATTAAGTGGAAATGG + Intronic
1065064550 10:21947477-21947499 TACTATTCATTAAGTGGAAGTGG - Intronic
1065422257 10:25558386-25558408 TTCTTTTCTTTATGTGAAGTCGG + Intronic
1065446314 10:25805192-25805214 TACTATTCATTAAGTGGAAGTGG - Intergenic
1065460711 10:25960634-25960656 TACTGTTCATTAAGTGGAAGTGG + Intronic
1065996170 10:31061444-31061466 TACTATTCATTAAGTGGAAGTGG + Intergenic
1066090214 10:32011077-32011099 TTTTTTTTCTTAAGAGAAAATGG - Exonic
1066094194 10:32056679-32056701 TTCTTTTCTTTGAGGGAGAAGGG + Intergenic
1066423063 10:35279582-35279604 TTCTTATCATGAAGAGAAGAAGG - Intronic
1066433380 10:35373657-35373679 TACTATTCATTAAGTGAAAGTGG - Intronic
1066678208 10:37910782-37910804 TACTATTCATTAAGTGGAAGTGG + Intergenic
1067315136 10:45154365-45154387 TGCTTTCCATAAAGTGAAACAGG + Intergenic
1068020070 10:51570410-51570432 TACTGTTCATTAAGTGGAAATGG + Intronic
1068113688 10:52711918-52711940 ATCCTTCCATTAAGTGTAAATGG - Intergenic
1068301869 10:55153715-55153737 TTCTTTTCACTACATGAAACTGG - Intronic
1068379240 10:56227784-56227806 TTGTTTTCATTACCTGAAAATGG + Intergenic
1068522072 10:58087777-58087799 TTCTATTTGTTAAGTGGAAATGG - Intergenic
1068568382 10:58600763-58600785 TACTATTCATTAAGTGGAAGTGG - Intronic
1068597639 10:58920287-58920309 TTCCTTTCTTTAACTGCAAAAGG + Intergenic
1068911217 10:62380322-62380344 TACTTCTCATTAAATGGAAATGG - Intronic
1068913397 10:62403234-62403256 TTATATTCATTAAGTGGAAGTGG + Intronic
1068950711 10:62774370-62774392 ATCATTTCATTAAATGAAAAGGG + Intergenic
1069074449 10:64023789-64023811 TACTATTCATTAAGTGGAAGTGG + Intergenic
1069266063 10:66459149-66459171 TACTATTCATTAAATGGAAATGG - Intronic
1070218174 10:74408767-74408789 TATTATTCATTAAGTGGAAATGG + Intronic
1070367193 10:75749143-75749165 TACTATTCATTAAGTGAAAGTGG - Intronic
1071010551 10:80935402-80935424 TACTATTCATTAAGTGGAAATGG - Intergenic
1071283167 10:84121159-84121181 TGCTGTTCATACAGTGAAAAGGG - Intergenic
1071474370 10:86012939-86012961 TTCCTTTCCTTCAGTGCAAAGGG - Intronic
1071697577 10:87893232-87893254 TACTATTCATTAAGTGGAAGTGG + Intronic
1071781362 10:88849325-88849347 TTCTTTCCACTAAGGGAACAGGG + Intronic
1071805045 10:89109544-89109566 TGCTATTCATTAAGTGGAAATGG + Intergenic
1071816604 10:89238678-89238700 TACTATTCATTAAGTGGAAGTGG - Intronic
1071920072 10:90339851-90339873 TTCTTTTCATTAAGAGGAAGAGG + Intergenic
1072642062 10:97219157-97219179 TACTATTCATTAAGTGGAAGTGG - Intronic
1073220525 10:101868635-101868657 TACTATTCATTAAGTGGAAGTGG - Intronic
1073709953 10:106025040-106025062 TACTATTTATTAAGTGGAAATGG - Intergenic
1073744416 10:106449067-106449089 TTTTTTTAAGTAAGAGAAAATGG + Intergenic
1073965411 10:108983430-108983452 TCCTATTCATTAAGTGAAAATGG + Intergenic
1074065843 10:110012986-110013008 TTTTTTTCTTTCAATGAAAATGG + Intronic
1074107183 10:110397279-110397301 TACTCTTCATTAAATGAAAGTGG + Intergenic
1074322793 10:112418781-112418803 TACTATTCATTAAGTGGAAATGG + Intronic
1074345731 10:112684212-112684234 TTATTTGCATTAAGAGTAAACGG + Intronic
1074379602 10:112968375-112968397 TACTATTCATTAAGTGGAAGTGG - Intronic
1075183008 10:120228947-120228969 TGCTATTCATTAAGTGGAAGTGG + Intergenic
1075728987 10:124625295-124625317 ATCTTTTGATTAACTGAGAAAGG + Intronic
1076312556 10:129518623-129518645 TACTATTCATTAAGTGGAAGTGG - Intronic
1076593406 10:131607962-131607984 TGTATTTCATTATGTGAAAATGG + Intergenic
1077271264 11:1683166-1683188 TTATTTAAATTAAGTAAAAAAGG + Intergenic
1078500781 11:11873187-11873209 TTCTTTTTATTAACTGAAGAAGG + Intronic
1078618092 11:12883268-12883290 GCCTTTTGATTAAGTAAAAAGGG + Intronic
1078719955 11:13875292-13875314 TACATTTCATTAATTGATAATGG - Intergenic
1078747298 11:14127744-14127766 TTCTTTATATCATGTGAAAATGG - Intronic
1078784842 11:14479235-14479257 TTCTCTTCATTAAATGTGAAAGG + Intronic
1078836151 11:15031941-15031963 TACTATTCATTAAGTGGAAGTGG - Intronic
1079233901 11:18673699-18673721 TACTATTCATTAAGTGGAAGAGG - Intergenic
1079369926 11:19842861-19842883 ATCTTTTCATTTGCTGAAAAAGG - Exonic
1080118620 11:28648463-28648485 TCCTTATCATTAAGAGAGAATGG - Intergenic
1080988662 11:37503679-37503701 TTCTGTTCCACAAGTGAAAATGG + Intergenic
1081156100 11:39692982-39693004 AACTATTCATTAAGTGGAAATGG - Intergenic
1081226740 11:40533159-40533181 TATTTTTCAATATGTGAAAATGG + Intronic
1081246785 11:40776928-40776950 TTCTTTGAAATAAGTGAAAAAGG - Intronic
1081389165 11:42508602-42508624 TACTATTCATTAAGTGGAAGTGG - Intergenic
1081475490 11:43426136-43426158 TTCTCATCATCAAGTGAAATAGG - Intronic
1081479745 11:43474880-43474902 TACTGTTCATTAAGTGGAAGTGG + Intronic
1081493058 11:43581815-43581837 TTCTTTGCATTGAGTGAATGGGG - Intronic
1081949637 11:47033032-47033054 TACTATTCATTAAGTTAAAGTGG + Intronic
1081970579 11:47195615-47195637 TTTTTTTCATCAATTTAAAACGG - Intergenic
1082156120 11:48816851-48816873 TCTTTTTTAGTAAGTGAAAATGG + Intergenic
1082825358 11:57573832-57573854 TACTATTCATTAAGTGGAAGTGG + Intergenic
1082930300 11:58596186-58596208 TACTATTCATTAAGTGTAAGTGG + Intronic
1082939497 11:58689081-58689103 TTCTTTTCATTAAGCAGAGAAGG - Intronic
1083090498 11:60194378-60194400 TTCTCTTCCTTAAGGGAAATTGG + Intergenic
1083249639 11:61457744-61457766 TACTATTCATTAAGTGGAAGTGG + Intronic
1083501996 11:63117641-63117663 TACTATTCATTAAGTGGAAATGG - Intronic
1083519709 11:63297066-63297088 TTCTTATTATTAAGTGATGAAGG + Intronic
1084515250 11:69634471-69634493 TTTTTTTCAATAACTCAAAAGGG + Intergenic
1085489341 11:76900194-76900216 TACTATTCATTAAGTGGAAGTGG + Intronic
1085549553 11:77355757-77355779 TTATTTTCAGTAGGTGAAATGGG + Exonic
1086078871 11:82882052-82882074 TATTATTCATTAAGTGAAAGTGG + Intronic
1086377558 11:86216472-86216494 TTTTTTTCATTTAGTGATTACGG - Intergenic
1086667873 11:89506719-89506741 TTCTTATCATTAAGTCGTAAAGG - Intergenic
1086872222 11:92052024-92052046 TACTATTCATTAAGTGGAAGTGG + Intergenic
1086957947 11:92953396-92953418 TACTATTCATTAAGTGGATATGG + Intergenic
1087260476 11:96005445-96005467 TTCCTTTGATTAAATAAAAATGG - Intronic
1087382160 11:97419907-97419929 TACTTTGCTTTAATTGAAAATGG - Intergenic
1087427462 11:98008720-98008742 TACTATTTATTAAGTGTAAATGG - Intergenic
1087777776 11:102272317-102272339 TTCTATTCGTTCAGTGAAATAGG - Intergenic
1088146199 11:106682795-106682817 TTCTTTCCTTTAATTAAAAAAGG - Intronic
1088856644 11:113761281-113761303 TTCTTTTTTTTAATTGAAACAGG + Intronic
1088940598 11:114451420-114451442 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1089100744 11:115960200-115960222 TACTATTCATTAAGTGGAAGTGG + Intergenic
1089175473 11:116545862-116545884 TCCTATTCATTAAGTGGAAGTGG - Intergenic
1089914087 11:122135358-122135380 TACTATTCATTAAGTGGAAGTGG - Intergenic
1090371225 11:126254519-126254541 TTCTTTTCATTAAGTGAAAACGG + Intronic
1090562978 11:127953127-127953149 CTCTTTTCTTAAAGTCAAAAAGG + Intergenic
1090899595 11:131016502-131016524 TACTATTCATTAAGTAGAAATGG + Intergenic
1091078909 11:132647610-132647632 TACTGTTCATTAAGTGCAAGTGG + Intronic
1091955037 12:4633105-4633127 TTTTTTTTTTTAATTGAAAAGGG - Intronic
1092043863 12:5410734-5410756 TTCCTTTAATTAAGTAAAACGGG - Intergenic
1092059908 12:5539912-5539934 TACTATTCATTAAGTGGAAGCGG - Intronic
1092061966 12:5558323-5558345 TGCTTTTCAGTAAGAGAAATAGG - Intronic
1092981824 12:13803056-13803078 TACTATTCATTAAGTGGAAGTGG - Intronic
1093122780 12:15292768-15292790 TTATGTTCTTTAATTGAAAATGG + Intronic
1093371104 12:18366158-18366180 ATCTTTTCACTGAGTGAAATGGG - Intronic
1093588181 12:20868016-20868038 TACTATTCATTAAGTGGAAGTGG - Intronic
1093607275 12:21107943-21107965 TACTATTCATTAAGTGGAAGTGG + Intronic
1093682590 12:22019858-22019880 TACTGTTTATTAAGTGAAAGTGG - Intergenic
1093684038 12:22036168-22036190 TACCTTTTATTAAGTGAAAGTGG - Intergenic
1093870159 12:24281442-24281464 TTCTATTTATTAAGCTAAAAAGG + Intergenic
1093888374 12:24489638-24489660 TTCTTTTTATTAAGTGATCTGGG - Intergenic
1093985475 12:25527163-25527185 TTCTTTATTTTAAGTGAAATAGG - Intronic
1094122485 12:26988936-26988958 TACTATTCATTAAGTGAGAGTGG - Intronic
1094407663 12:30135196-30135218 TACTATGCATTAAGTGTAAATGG - Intergenic
1094447767 12:30550280-30550302 TACTATTCATTAAGTGGAAGTGG - Intergenic
1094609158 12:31976715-31976737 TACTATTCATTAAGTGGAAATGG + Intronic
1094629957 12:32164085-32164107 TTCGTTTCACTAAGAGAAGAAGG - Intronic
1094677982 12:32639986-32640008 AACTCTTCATTCAGTGAAAAGGG - Intronic
1095120177 12:38407713-38407735 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1095187383 12:39216445-39216467 TACTATTCATTAAGTGGAAGTGG - Intergenic
1095270996 12:40218911-40218933 TACTGTTTATTAAGTGAAAGGGG - Intronic
1095296166 12:40530000-40530022 TTTTTTTCATTAGGTAAATATGG + Intronic
1095460023 12:42433692-42433714 TACTATTCATTAAGTGGAAGTGG + Intronic
1095471719 12:42543986-42544008 TACTATTCATTAAGTGGAAGTGG + Intronic
1095610432 12:44121483-44121505 TACTATTCATTAAGTGGAAATGG - Intronic
1095804313 12:46301901-46301923 CTCTTTTCATCAAGTGGAAAAGG + Intergenic
1095809956 12:46362698-46362720 TTCTTTTCATTCATTGAAGCTGG - Intronic
1096383389 12:51177919-51177941 TACTATTCATTAAATGGAAATGG - Intergenic
1097320083 12:58215882-58215904 TTTTTCTAATTATGTGAAAAGGG + Intergenic
1097327763 12:58298114-58298136 TTGTTTGCATGAAGTGAACACGG - Intergenic
1097440974 12:59608384-59608406 TTCTTGTTCTGAAGTGAAAAAGG + Intronic
1097467320 12:59943593-59943615 TTCTTTTCTTTGGTTGAAAAAGG + Intergenic
1097536536 12:60877968-60877990 TTCTTTGCTTTAAGTGAGACGGG + Intergenic
1097687849 12:62707809-62707831 TACTATTCATTAAGTGAACCAGG - Intronic
1097730939 12:63127218-63127240 TCCTATTCATTAAGTGCAAGTGG - Intergenic
1097935197 12:65241318-65241340 GTTGCTTCATTAAGTGAAAAAGG - Intronic
1098005679 12:65994599-65994621 TACTATTCATTAAGTGAAAGTGG - Intergenic
1098118524 12:67208320-67208342 TTCTTTTCATGAGGTGTTAAGGG - Intergenic
1098196472 12:68007177-68007199 TTCGTTTCATAATGTGGAAATGG - Intergenic
1098268661 12:68749267-68749289 TTCTTATCAGTAAGTGGTAAAGG + Intronic
1098929146 12:76389829-76389851 TAATTTTCATTAATTGATAAAGG - Exonic
1098986080 12:77013796-77013818 TACTATTCATTAAATGAAACTGG - Intergenic
1099146383 12:79050239-79050261 TACTATTCATTAAGTGGAAGTGG + Intronic
1099288010 12:80739382-80739404 TACTATTCATTAAGTGGAAGTGG + Intergenic
1099440448 12:82692861-82692883 TTTTTTTCATTGGGTGAAAAAGG + Intronic
1099598840 12:84704925-84704947 TTCTTTTCATTTTCTGAATATGG + Intergenic
1100051503 12:90454496-90454518 TTCATTTAGTTAAGTGAAATTGG + Intergenic
1100384706 12:94095063-94095085 TACTATTCATTAAGTGGAATTGG + Intergenic
1101277438 12:103217971-103217993 TTCGTTTCTATAAGTGAAAAGGG - Intergenic
1101285637 12:103309330-103309352 TACTATTCATTAAGTGGAAGTGG - Intronic
1101559805 12:105845698-105845720 TACTATTCATTAAGTGGAAGTGG - Intergenic
1101738247 12:107479860-107479882 TTCTTTTCCTTAGCTGAAAGTGG - Intronic
1102430698 12:112880889-112880911 TACTATTCATTAAGTGGAAGTGG + Intronic
1102937995 12:116913552-116913574 TACTATTCATTAAGTGAAAGTGG + Intronic
1104135037 12:125929551-125929573 TTGTATTCATTAAGTGGAAGTGG - Intergenic
1104296375 12:127518546-127518568 TGCTATTCATTAAGTGGAAGTGG + Intergenic
1104361408 12:128136702-128136724 TACTATTCATTAAGTGCAAGTGG + Intergenic
1104878066 12:132050403-132050425 TCATTTTCATTAAGTCAAAGTGG - Exonic
1105204024 13:18204663-18204685 TACTATTCATTAAGTGAAAGTGG + Intergenic
1105485759 13:20829968-20829990 TTATTTACATTAAGGGAAAATGG + Intronic
1105618726 13:22046311-22046333 TTCTATGCATTGAGTGGAAATGG - Intergenic
1105675429 13:22666382-22666404 TACTCTTCATTAAGTGGAAATGG - Intergenic
1105685071 13:22772540-22772562 TTCTTTTCACAAAAAGAAAAAGG + Intergenic
1105775906 13:23659897-23659919 TACTCTTCATTAAGTGGAAGCGG + Intronic
1105919274 13:24945856-24945878 TTCTTTGCAATTAATGAAAATGG + Intergenic
1106310168 13:28547315-28547337 ATCATTTCTTTAAGTGAAAGGGG + Intergenic
1106423629 13:29604865-29604887 TACTAGTCATTAAGTGAAAGTGG - Intergenic
1106466256 13:30016933-30016955 TACTATTCATTAAGTGGAAGTGG - Intergenic
1106495676 13:30272096-30272118 TTCTTGTAATTAAGAAAAAAGGG + Intronic
1106532838 13:30610041-30610063 TACTAATCATTAAGTGGAAATGG - Intronic
1106625468 13:31416677-31416699 TACTCTTCATTAAGTGCAAGGGG - Intergenic
1106711281 13:32336185-32336207 TATTTTTCACTAAGTTAAAAAGG - Intronic
1106736598 13:32593716-32593738 TGCTATTCATTAAGTGGAAGTGG + Intronic
1106794862 13:33194735-33194757 TTCTTTGGAGAAAGTGAAAATGG + Intronic
1106806348 13:33311674-33311696 CTCTGTTCATTGAGTCAAAACGG + Intronic
1106855704 13:33849554-33849576 TTTTTTTTTTTAAGTGAGAAAGG + Intronic
1107232002 13:38121043-38121065 TACTTTTCATTAAGTGGAAGTGG - Intergenic
1107233693 13:38142676-38142698 TACTATTCATTAAGTGGAAAAGG - Intergenic
1107250557 13:38355724-38355746 TACTATTCATTAAGTGGAAAAGG + Intronic
1107250684 13:38357783-38357805 TACTATTCATTAAGTGGAAGTGG + Intronic
1107374848 13:39792483-39792505 TACTATTCATTAAGTGGAAGTGG + Intergenic
1107589636 13:41889340-41889362 TGCTTATTATTAAGTGAGAAGGG - Intronic
1107792987 13:44021159-44021181 TTCTTTTTAATAGGTTAAAATGG + Intergenic
1108009788 13:45994120-45994142 TACTATTCATTAAGTGGAAATGG - Intronic
1108146028 13:47477933-47477955 TTCTTTTCTTTAACTGACATTGG + Intergenic
1108467358 13:50730079-50730101 TACTATTCATTAAGTGGAAGTGG + Intronic
1108584143 13:51853445-51853467 TACTATTCATTAAGTGTAAATGG + Intergenic
1109200044 13:59420257-59420279 TACTATTTATTAAGTGGAAATGG + Intergenic
1109577246 13:64275919-64275941 TTCTTCTTATTAAAAGAAAATGG + Intergenic
1109610146 13:64754383-64754405 TTGTTTTCATGAGGTGATAAAGG - Intergenic
1109996031 13:70128238-70128260 TAATGGTCATTAAGTGAAAATGG + Intergenic
1110629563 13:77692263-77692285 TTTTTTTCTTTAATTGAAAATGG - Intergenic
1110807518 13:79774286-79774308 TAGTATTCATTAAGTGAAAGTGG + Intergenic
1111025613 13:82517655-82517677 TACTATTCATTAAGTGGAAGTGG - Intergenic
1111129547 13:83956846-83956868 TAATTGTCATTCAGTGAAAATGG + Intergenic
1111135884 13:84043163-84043185 TTCTTCTCTATATGTGAAAATGG - Intergenic
1111511262 13:89266174-89266196 TTCATTTCATAAAATGTAAATGG - Intergenic
1111625852 13:90785864-90785886 CACTTTTCATCAAGTGATAATGG - Intergenic
1111764931 13:92516606-92516628 TTCTTTACAGCAACTGAAAAAGG - Intronic
1111816595 13:93161609-93161631 TAATATTCATTAAGTAAAAATGG - Intergenic
1112067306 13:95807208-95807230 TACTATTCATTAAGTGCAAGTGG + Intronic
1112227011 13:97549713-97549735 TACTATTCATTAAGTGTAAGTGG - Intergenic
1112240405 13:97676011-97676033 TTCTTTTCAAACAGGGAAAAAGG + Intergenic
1112272667 13:97983907-97983929 TTCTTTTCTGTAACTCAAAATGG + Intronic
1112406955 13:99129754-99129776 TAGTATTCATTAAGTGAAAGTGG + Intergenic
1112612992 13:100975195-100975217 TTCCTTTTAGGAAGTGAAAATGG - Intergenic
1112708143 13:102095694-102095716 TGCTCTTCATTAAGTGGAAGTGG - Intronic
1113235923 13:108273995-108274017 TACTATTCATTAAGTGGAAGTGG - Intronic
1113617951 13:111694413-111694435 TACTATTCATTAAGTGGAAGCGG + Intergenic
1113623484 13:111779674-111779696 TACTATTCATTAAGTGGAAGCGG + Intergenic
1114287304 14:21257038-21257060 ATTGTTTCATTAACTGAAAAAGG + Intronic
1115176844 14:30572719-30572741 TTCTTTTAATTAAAAAAAAAAGG - Intronic
1115283499 14:31691251-31691273 TACTATTCATTAAGTGGAAGTGG - Intronic
1115401565 14:32967205-32967227 TACTATTCATTAAGTGGAAGTGG - Intronic
1115424357 14:33239200-33239222 TTCTTTTAGTTAAGTGATAAAGG + Intronic
1115429244 14:33297712-33297734 TTCCTTTCATTAGGAGGAAATGG + Intronic
1115618268 14:35117035-35117057 TTCTTTTCATTGAATGAATTAGG - Intronic
1115701502 14:35957858-35957880 TTCTTTTTATAAAAGGAAAAGGG + Intergenic
1116219564 14:42065590-42065612 TTCTTTTTAATCCGTGAAAATGG + Intergenic
1116222270 14:42103684-42103706 TCAATTTCATCAAGTGAAAAAGG + Intergenic
1116374177 14:44176394-44176416 TAGTATTCATTAAATGAAAATGG - Intergenic
1116798739 14:49420064-49420086 TTCTTTTTTTTAATTGAAACAGG + Intergenic
1117384694 14:55199660-55199682 TACTATTCATTAAGTGAAAGTGG + Intergenic
1117422633 14:55562043-55562065 TACTATTCATTAAGTGGTAATGG + Intronic
1117759502 14:59012354-59012376 TTCTTTTTCTTAATTGATAAGGG + Intergenic
1118164176 14:63319962-63319984 TTCTTTGCAGAAAGTGGAAATGG - Intergenic
1118405652 14:65421240-65421262 TACTCTTCATTAAGTGGAAGTGG + Intronic
1118650799 14:67892254-67892276 TTATTTTCACTAACTGATAAAGG - Intronic
1118998021 14:70855083-70855105 TTAGTCTCATTAAGTTAAAAAGG - Intergenic
1119553066 14:75530593-75530615 TTCTGTACTTTAAGTTAAAAAGG + Intronic
1119608881 14:76044871-76044893 TACTACTCATTAAGTGGAAATGG - Intronic
1120249392 14:82043903-82043925 TTCTGTTCATCATGTGAATAGGG + Intergenic
1120455316 14:84722582-84722604 TTATTTGAATTAAATGAAAACGG + Intergenic
1120568514 14:86089315-86089337 TGGTATTCATTAAGTGAAAGTGG + Intergenic
1120663785 14:87281308-87281330 TTCTGTTAAATAAGTCAAAAAGG - Intergenic
1120699803 14:87686546-87686568 TACTATTCATTAAGTGAGAGTGG - Intergenic
1121071437 14:91025800-91025822 TTTTTTTTTTTAAGAGAAAAAGG - Intronic
1121140303 14:91536042-91536064 TTCTATCCATGAAATGAAAATGG + Intergenic
1121550719 14:94797638-94797660 ATCTTTTAGTTAAGTGAAAATGG - Intergenic
1121914455 14:97823970-97823992 TACTATTCATTAAGTGGAAGTGG + Intergenic
1122185560 14:99991166-99991188 TACTATTCACTAAGTGGAAATGG - Intronic
1122317107 14:100832489-100832511 CTGTGTTCATTAAGGGAAAAGGG - Intergenic
1123872588 15:24592119-24592141 ATGGTTTCATTAAATGAAAACGG - Intergenic
1123900270 15:24869775-24869797 TTATTTTCAAAAAGTGAAACAGG - Intronic
1123993104 15:25698373-25698395 TACTATTCATTAAGTGAAAGCGG - Intronic
1124406770 15:29399840-29399862 TACTATTCATTAAGTGGAAGTGG + Intronic
1124448129 15:29758005-29758027 TACTGTTCATTAGGTGAAAGTGG - Intronic
1124465103 15:29931180-29931202 TACTGTTCATTAAGTGGAAGTGG + Intronic
1124715269 15:32054270-32054292 TATATTTCATTAAGTGCAAATGG + Intronic
1125099683 15:35897576-35897598 ATCATTTCATTAAATGTAAATGG - Intergenic
1125127148 15:36237499-36237521 TTCTTTCCATAAAGTATAAATGG + Intergenic
1125206820 15:37162588-37162610 TACTTTTCATTAAGTGGAAGTGG - Intergenic
1125547868 15:40521014-40521036 TACTATTCATTAAGTGGAAGTGG + Intergenic
1125978871 15:43981358-43981380 TACTATTCATTTAGTGTAAATGG + Intronic
1126797272 15:52269699-52269721 TTTTTTTTTTTAAGAGAAAATGG + Intronic
1127176013 15:56358427-56358449 TTTTTTTTTTTAAGTTAAAAGGG - Intronic
1127293833 15:57592475-57592497 TTCTTTTAATTAATGGAAGAAGG - Intronic
1127464849 15:59234087-59234109 TTCCTTTCATTCAGAGAAAGAGG + Intronic
1127607204 15:60598493-60598515 TACTATTCATTAAGTGGAAGTGG - Intronic
1127623820 15:60760646-60760668 TGCTATGCATTAGGTGAAAATGG - Intronic
1127635296 15:60863750-60863772 TTCTTTTCATTATCACAAAAGGG + Intronic
1127707299 15:61559911-61559933 TACTATTCATTAAGTGGAAGTGG - Intergenic
1127830623 15:62747879-62747901 TACTTTTCACTAAGTGGAAGTGG + Intronic
1127938458 15:63667928-63667950 TACTATTCATTAAGTGGAAGTGG - Intronic
1128139766 15:65290866-65290888 TACTATTCATTAAGTGGAAGTGG - Intronic
1128974385 15:72139298-72139320 TACTATTCATTAAGTGGAAATGG + Intronic
1129131564 15:73502542-73502564 TACTTTTTATTAAGTGGAAGTGG + Intronic
1129811679 15:78516248-78516270 TACTATTTATTAAGTGGAAATGG + Intronic
1130065393 15:80598761-80598783 TACTATTCATTAAGTGGAAGTGG - Intergenic
1130666425 15:85873468-85873490 TTCCTTTCTCTAAGTGCAAAAGG + Intergenic
1131339581 15:91584801-91584823 TTCTTTTCAGAAAGTGGTAATGG + Intergenic
1131623960 15:94098181-94098203 TACTCTTCATTAAGTGGAAGTGG - Intergenic
1131625964 15:94121007-94121029 TGCTGTTCATTAAGTGGAAGTGG - Intergenic
1131829761 15:96346418-96346440 TTCTTTTGAATGAGTTAAAATGG + Intergenic
1132166450 15:99596607-99596629 TCCATTTCATCAAATGAAAATGG - Intronic
1133148871 16:3811442-3811464 TACCATTCATTAAGTGAAAGTGG - Intronic
1133683394 16:8142459-8142481 TTTTTTTCATTAGTTTAAAATGG - Intergenic
1134821984 16:17254308-17254330 TACTGTTCATTAAGTGGAAGTGG - Intronic
1135682565 16:24470626-24470648 TACTATTCATTAAGTGGAAGCGG - Intergenic
1135834357 16:25811352-25811374 TACTATTCATTAAGTGAAAGTGG - Intronic
1135923823 16:26674631-26674653 TCCTATTCATTAAGTGGAAGTGG + Intergenic
1136001502 16:27297599-27297621 GTCTTTTCAATAAATGATAAAGG - Intergenic
1136489023 16:30593112-30593134 TACTATTCATTAAGTGGAAGTGG - Intergenic
1137246130 16:46706666-46706688 TACTATTCATTAAGTGAAAGTGG + Intergenic
1137329517 16:47477772-47477794 TTCTTTCCCTGAAGAGAAAATGG + Intronic
1137451018 16:48573886-48573908 TACTATTCATTAAGTGGAAGTGG + Intronic
1138070661 16:53989906-53989928 TACTATTCATTAAGTGGAAGTGG - Intronic
1138147908 16:54628630-54628652 TTCTTTTTATTATCTGGAAATGG + Intergenic
1138158751 16:54732472-54732494 TTATGCTCATTAAGTGAAAGTGG + Intergenic
1138237310 16:55395398-55395420 TATTATTCATTAAGTGAAAGTGG - Intronic
1138956206 16:61973253-61973275 TACTATTCATTAAGTGGAAGTGG - Intronic
1139322148 16:66123548-66123570 TACTATTCATTAAGTGGAAGTGG + Intergenic
1139813595 16:69646218-69646240 TGCTTTTCATTATGTCATAAAGG + Intronic
1140355785 16:74305013-74305035 TTTTTTTCCTTAAGTGGAAATGG + Intronic
1141302232 16:82827731-82827753 CTATTTTCATCAAGTAAAAAAGG - Intronic
1142320302 16:89377943-89377965 TACTTCTCATTAAGTGGAAGTGG - Intronic
1142976367 17:3647031-3647053 CTCTGTTCATGAAGTCAAAATGG - Intronic
1143073860 17:4322575-4322597 TTCTCCACATTAAGTAAAAATGG + Intronic
1143728640 17:8867292-8867314 GTCTTTTCATCTTGTGAAAATGG + Intronic
1143754976 17:9060249-9060271 TACTGTTCATTAAGTGGAAGTGG - Intronic
1143762027 17:9111781-9111803 TACTATTCATTAAGTGGAAGTGG + Intronic
1144229338 17:13184715-13184737 TACTATTCATTAAGTGGAAGTGG + Intergenic
1144277489 17:13687928-13687950 TACTATTCATTAAGTGGAAGTGG - Intergenic
1144279096 17:13706724-13706746 TACTATTCATTAAGTGGAAGTGG + Intergenic
1144409319 17:14985175-14985197 TACTATTCATTAAGTGGAAGTGG - Intergenic
1144484070 17:15650685-15650707 TTTATTTCATTAATTGACAATGG + Intronic
1144530132 17:16030197-16030219 TACTATTCATTAAGTGGAAGTGG + Exonic
1144554175 17:16267251-16267273 TACTATTCATGAAGTGGAAATGG + Intronic
1144697024 17:17311468-17311490 GTCTTTTCAATAAATGAAACTGG - Intronic
1145231185 17:21174521-21174543 AGCTTTTCAATAAATGAAAATGG + Intronic
1146246780 17:31292363-31292385 TTCTTATTATTAATGGAAAAAGG - Intronic
1146608399 17:34283190-34283212 TTCTTTTTTTTAATTGGAAAAGG - Intergenic
1147524424 17:41207291-41207313 TACTGTTCATTAAGTGGAAGTGG + Intronic
1148066010 17:44870638-44870660 TACTGTTCATTAAGTGGAAGTGG - Intronic
1148448706 17:47759037-47759059 TATTATTCATTAAGTGAAAGTGG + Intergenic
1149279187 17:55083308-55083330 ATATCTTCATTTAGTGAAAAAGG - Intronic
1149313056 17:55414637-55414659 TTATTGTCATTTAGTGAAAAGGG + Intronic
1149587202 17:57799523-57799545 TGCTATTCATTAAGTGGAAGCGG + Intergenic
1149669451 17:58393089-58393111 TACTATTCATTAAGTGAAAGTGG - Intronic
1149802400 17:59582057-59582079 TTTTTTTCATTTGGGGAAAAAGG + Intronic
1149802441 17:59582687-59582709 TTTTTTTCATTTGGTAAAAAGGG + Intronic
1149816993 17:59735340-59735362 TTCTTTTCATTCACTGAAGAGGG - Exonic
1149844050 17:59992806-59992828 TTTTTTTCATTTGGTAAAAAGGG - Intergenic
1149844092 17:59993436-59993458 TTTTTTTCATTTGGGGAAAAAGG - Intergenic
1150439891 17:65182624-65182646 TTGTTTTCTTCATGTGAAAAAGG - Intronic
1150660746 17:67075128-67075150 TTCTTTTCATGATCTAAAAATGG - Exonic
1150662077 17:67091113-67091135 TGTTTTACATTGAGTGAAAATGG - Intronic
1150814257 17:68380126-68380148 TTCTATTCATTAAGTGGAAGTGG - Intronic
1150853097 17:68724605-68724627 TACTATTCATTAAGTGGAAGTGG + Intergenic
1150938105 17:69659464-69659486 TACTATTCATTAAGTGGAAGTGG - Intergenic
1151145891 17:72040662-72040684 TTCTTTTCATGGAAAGAAAAGGG + Intergenic
1151216166 17:72577824-72577846 TACTATTCATTAAGTGGAAGGGG - Intergenic
1151230526 17:72681776-72681798 TACTATTCATTAAGTGGAAGTGG - Intronic
1152370175 17:79882735-79882757 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1153107820 18:1548720-1548742 TTCACCTCATTAAGTGATAAAGG + Intergenic
1153362167 18:4209351-4209373 TACTGTCCATTAAGTGAAAATGG - Intronic
1153409406 18:4777011-4777033 TACTATTCATTAAGTGGAAGCGG - Intergenic
1153536727 18:6109854-6109876 CTCTTTTATTTAAGGGAAAAAGG - Intronic
1153781472 18:8498894-8498916 TACTATTCATTAAGTGGAAGTGG + Intergenic
1153807581 18:8722605-8722627 TACTATTCATTAAGTGGAAGTGG + Intronic
1153919868 18:9778963-9778985 TACTATTCATTAAGTGGAAATGG + Intronic
1154353751 18:13609190-13609212 TTCCCTTCATTCAGAGAAAATGG - Intronic
1154408871 18:14124221-14124243 TTCTTTTCTTCAAGAAAAAATGG - Intronic
1155076785 18:22364371-22364393 TACTATTCATTAAGTGGAAGTGG - Intergenic
1155231248 18:23777448-23777470 TACTTTTCACTAAGTGACAGAGG + Intronic
1155528462 18:26741802-26741824 TTGTTTTCATTATGACAAAATGG - Intergenic
1155719233 18:28990243-28990265 TACTATTCATTAAGTGGAAATGG - Intergenic
1155790463 18:29961851-29961873 TTGTTGTCATTAAGTGAATATGG - Intergenic
1155844300 18:30686285-30686307 TACTATTTATTAAGTGGAAATGG + Intergenic
1156009905 18:32484832-32484854 TACTATTCATTAAGTGGAAGTGG + Intergenic
1156426311 18:37017161-37017183 TTCTTTGAAATAAATGAAAAAGG - Intronic
1156725896 18:40126639-40126661 TTTATTACTTTAAGTGAAAATGG - Intergenic
1156933748 18:42677569-42677591 TTTTTTTCCTCAAGTGAAATGGG - Intergenic
1157044631 18:44086176-44086198 TTCTTTTCATTGACTTAACAAGG - Intergenic
1157090362 18:44629711-44629733 TTCTTTTCTTTTTGTGAAATGGG + Intergenic
1157111575 18:44825409-44825431 ATTTTTTCATCCAGTGAAAAAGG + Intronic
1157241000 18:46009244-46009266 TGGTTTTCCTTAAGTGGAAATGG + Intronic
1157911789 18:51623332-51623354 AGCTTTTCATTAAGAGAACATGG + Intergenic
1157925635 18:51762997-51763019 TTATATTCCTTAAGGGAAAAGGG + Intergenic
1157928657 18:51794422-51794444 AACTATTCATTAAGTGAAAATGG - Intergenic
1157929944 18:51810763-51810785 TACTTTTCATTAAGTGGAAGTGG + Intergenic
1158089899 18:53698672-53698694 TACTATTCATTAAGTGGAAGTGG + Intergenic
1158189373 18:54808780-54808802 TTCTGTTCATTTAGTGATATGGG - Intronic
1158196940 18:54897923-54897945 TACTATTCATTATGTGAAAGTGG + Intergenic
1158284137 18:55860356-55860378 TCCATATCGTTAAGTGAAAATGG + Intergenic
1158301261 18:56055902-56055924 TACTGTTCATTAAGTGGAAATGG + Intergenic
1158339832 18:56454014-56454036 TTTTTTTCATTAAAATAAAACGG + Intergenic
1158381718 18:56937985-56938007 TCCTATTCATTAAGTGAAAGTGG + Intronic
1158383830 18:56966431-56966453 TACTCTTCATCAAGTGGAAATGG - Intronic
1158532369 18:58275234-58275256 TGCTATTTATTAAGTGGAAATGG + Intronic
1158755034 18:60313063-60313085 TACTATTCATTAAGTGGAAGTGG - Intergenic
1158787638 18:60735006-60735028 TTTTTTTGCTTAAGTTAAAATGG - Intergenic
1158835891 18:61331796-61331818 TACTATTCATTAAGTGGAAGTGG - Intergenic
1159067075 18:63581975-63581997 TACTATTCATTAAGTGGAAGTGG - Intergenic
1159163075 18:64669384-64669406 TACTATTCATTCAGTGGAAATGG - Intergenic
1159268241 18:66112200-66112222 TACTATTCATTAAGTGGAAGTGG - Intergenic
1159312698 18:66730282-66730304 TATTTTTTATTAAGTTAAAAAGG + Intergenic
1159364120 18:67444337-67444359 TACTATTCATTAAGTGGAAGTGG + Intergenic
1159421727 18:68229895-68229917 TACTATTCATTAAGTGGAAGTGG - Intergenic
1159434019 18:68392410-68392432 TTCTTTCCATTAAGTGTAGGGGG - Intergenic
1159753220 18:72328626-72328648 TACATTTTATTAAGTGAAAGAGG + Intergenic
1159840935 18:73398457-73398479 TACTATTCATTAAGTGGAAGTGG + Intergenic
1160035327 18:75296362-75296384 TTTTTTTTTTTAAGTGAAATTGG + Intergenic
1160078053 18:75696415-75696437 TTCTTGTAATTGAGAGAAAATGG + Intergenic
1160212225 18:76890938-76890960 TCCTATTCATTAAGTGGAAGTGG - Intronic
1160311983 18:77802193-77802215 TGATGTTCATTAAATGAAAAAGG - Intergenic
1160425954 18:78779375-78779397 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1160667653 19:340511-340533 TACTATTCATTAAGTGGAAGTGG + Intronic
1162590005 19:11585206-11585228 ATCTTTTCATGCAGTGAAAAAGG + Intronic
1162857505 19:13480327-13480349 TACTATTCATTAATTGGAAAGGG - Intronic
1163445678 19:17345039-17345061 TTTTTTTCTTTAAGTAAAGATGG + Intergenic
1163971535 19:20800894-20800916 TTCTATTTATTAATTGCAAATGG + Intronic
1164198745 19:22998800-22998822 TTCTTTTCATAAAGTGTTACTGG - Intronic
1164832358 19:31332413-31332435 TTATATTCAGTAAGTGAAAATGG - Intronic
1164922409 19:32098591-32098613 TGCTGTTCACTAAGTGGAAATGG - Intergenic
1165588613 19:36945424-36945446 TACTATTCATTAAGTGGAAGTGG - Intronic
1166266843 19:41689732-41689754 TACTATTCATTAAGTGACAGTGG - Intronic
1167134505 19:47608911-47608933 TTTTTTTAATTAAATGCAAACGG - Intronic
1167941065 19:52946245-52946267 TTCTCTTCTTAAATTGAAAATGG - Intronic
1168111951 19:54197652-54197674 TACTATTCATTAAGTGGAAGTGG - Intergenic
1168429390 19:56265897-56265919 TGCTTTTCATTATGAGAAAATGG + Intronic
1168431069 19:56281156-56281178 TACTCTTCATTAAGTGGAAGTGG + Intronic
1168457363 19:56523525-56523547 ATCTTTTCATAATGTGAAAATGG - Intronic
1168664066 19:58189605-58189627 TTCTTTTTTTTAAATGACAAGGG - Intronic
925317132 2:2935219-2935241 TACTATTCATTAAGTGGAAGTGG + Intergenic
925565084 2:5243426-5243448 TTTTTTTCAGTGAGTCAAAAAGG + Intergenic
925789002 2:7464104-7464126 ATCATTTCATTAACTGTAAATGG - Intergenic
925957512 2:8981890-8981912 GTCTTTTTATTAAATAAAAAAGG - Intronic
925988820 2:9237235-9237257 TGCTTTTCAAAAAGTGAAAATGG + Intronic
926452275 2:13019738-13019760 TACTATTTATTAAGTGAAAGTGG - Intergenic
926668588 2:15552487-15552509 TACTGTTCATTAAGTGGAAGTGG - Intronic
926669737 2:15564963-15564985 TTTTTTTTTTTAAGTGGAAATGG + Intergenic
926907839 2:17822579-17822601 TTCTTTTCATTAAATTAAGTGGG + Intergenic
926989834 2:18666623-18666645 TACTATTCATTAAGTGGAAGTGG + Intergenic
927530387 2:23792652-23792674 TTTTTTTCCCTAAGTGAAATAGG - Intronic
927803580 2:26124028-26124050 TACTATTCATTAAGTGGAAGTGG - Intronic
927834973 2:26388310-26388332 TACTTTTCTTTAAATGATAAAGG + Intronic
927901187 2:26819869-26819891 TTCATTTCATTCAGTGAAAGAGG - Intergenic
929017239 2:37510565-37510587 TACTATTCATTAAGTGGAAGTGG - Intergenic
929474091 2:42227753-42227775 CACTATTCATTAAGTGGAAATGG - Intronic
929475031 2:42237770-42237792 TACTATTCATTAAATCAAAATGG + Intronic
929514335 2:42592822-42592844 TTCTACTCATTAAGGAAAAAAGG - Intronic
930079736 2:47435956-47435978 TTCCTCTTATTAAGTGAAATGGG - Intronic
930521974 2:52479121-52479143 TACTTTTCTTTAATTGAAATAGG + Intergenic
930564401 2:53001358-53001380 TAATTTTCATAAAGTGACAATGG + Intergenic
930570856 2:53085066-53085088 TTTTATTCATTAAGTGGATATGG - Intergenic
930729895 2:54718813-54718835 TACTATTCATTAAGTGGAAGTGG - Intergenic
930739339 2:54814039-54814061 TGCATTTCATCAACTGAAAACGG + Intronic
930761689 2:55045405-55045427 ATTTGTTCATTCAGTGAAAATGG - Intronic
930939007 2:56991021-56991043 TGCATTTCAGTAAGAGAAAATGG - Intergenic
930998394 2:57750756-57750778 TGCTATTCATTAAATGGAAATGG + Intergenic
931379543 2:61739625-61739647 TACTATTCATTAAGTGGAAGAGG + Intergenic
931553099 2:63468981-63469003 TTCTTGTATTTAAGAGAAAATGG - Intronic
931831237 2:66053589-66053611 TACTATTCATTAAGTGGAAGTGG + Intergenic
931925419 2:67067082-67067104 TCCTTTACATTTAGGGAAAAAGG + Intergenic
931954653 2:67407764-67407786 TACTATTCATTAAGTGAAAGTGG + Intronic
932029256 2:68166436-68166458 TACTCTTCATTAAGTGGAAGTGG + Intronic
932383864 2:71312614-71312636 TACTGTGCATTAAGTGAAAATGG + Intronic
932848935 2:75164859-75164881 TTATTTTCATAAAGTGTTAATGG - Intronic
932895665 2:75637269-75637291 TACAATTCATTAAGTGGAAATGG + Intergenic
932989939 2:76774538-76774560 TAGTATTCATTAAGTGAAAATGG + Intronic
933018266 2:77159575-77159597 TACTATTCATTAAATGAAAGGGG + Intronic
933083750 2:78028316-78028338 TTCTTTAGAGTAAGTTAAAACGG + Intergenic
933092076 2:78133863-78133885 TTCTCTTCATTCAGTGATCAAGG + Intergenic
933367992 2:81378938-81378960 TACTATTCATTAAGTGGAAGTGG - Intergenic
933826952 2:86170559-86170581 TTCTTTTACCTAAGTGACAAAGG - Intronic
933830664 2:86205334-86205356 TACTGTTCATTAAGTGGAAGTGG + Intronic
934034597 2:88078415-88078437 TTTGTTTCCTTATGTGAAAATGG - Intronic
934127257 2:88907951-88907973 TACTAGTCATTAAGTGAAAATGG - Intergenic
934606944 2:95702698-95702720 TTCTTTTCATTTAATAAAGAAGG + Intergenic
934967841 2:98738297-98738319 TGTGTTTTATTAAGTGAAAAAGG + Intergenic
935106186 2:100045745-100045767 TACTATTCATTAAGTGGAAGTGG - Intronic
935262127 2:101364669-101364691 TTCTTTTCATGAATTGAAAGGGG + Intronic
935803372 2:106722549-106722571 TACTATTCATTAAGTGGAAGTGG + Intergenic
935889717 2:107663130-107663152 TTCTTATCATTGAGTTAAAGAGG - Intergenic
936031891 2:109079215-109079237 TACTATTCATTAAGTGGAAGTGG - Intergenic
936444038 2:112582245-112582267 TACTATTCATTAAGTGGAAGTGG + Intergenic
936454803 2:112664733-112664755 TACTATTCATTAAGTGGAAATGG + Intergenic
936540339 2:113344822-113344844 TTCTTTTCATTTAATAAAGAAGG + Intergenic
936700068 2:115001191-115001213 TGCTGTTTATTAAGTGATAATGG - Intronic
936960872 2:118073174-118073196 TACTATTCATTAAGTGGAAGTGG - Intergenic
936985009 2:118300842-118300864 TACTATTTATTAAGTGAAAGTGG + Intergenic
937162376 2:119776696-119776718 TACTATTCATTAAGTGCAAGTGG - Intronic
937163559 2:119790672-119790694 GTAATTTCATTAAGTGTAAATGG - Intronic
937284233 2:120739718-120739740 TTCTTTTCACTAAGTGTCAGAGG + Intronic
937571961 2:123374342-123374364 TGCTTTTAATGAAGTCAAAAAGG - Intergenic
937582974 2:123511971-123511993 TACTATTCATTAAGTGGAAGTGG + Intergenic
937664223 2:124466154-124466176 TTATTTTCTTGAAGTAAAAATGG - Intronic
937727914 2:125188701-125188723 TTTTTTTCATTTTGTGAATAAGG - Intergenic
937860573 2:126705271-126705293 TACTATTCATTAAGTGCAAGTGG - Intergenic
938047723 2:128138147-128138169 ATCTTTTCATGACGTGGAAATGG + Intronic
938193743 2:129306859-129306881 TTTTTTTACGTAAGTGAAAAAGG + Intergenic
938557114 2:132435360-132435382 TTCTGTTTACTAAGTGAAAGTGG - Intronic
938774146 2:134526232-134526254 TTCTTTTTAATAAAAGAAAAGGG + Intronic
938811263 2:134855071-134855093 GTCTTTTCATTTGGTGAAGAAGG - Intronic
938824347 2:134990402-134990424 TACTCTTCATTAAGTGGAAGTGG - Intronic
938897629 2:135768063-135768085 TTCATTTTTTTAAATGAAAATGG - Intronic
938964574 2:136376915-136376937 TTGTTTTTATTAACTGAAAGAGG - Intergenic
939398052 2:141657913-141657935 TCCTTTCTATTAATTGAAAAAGG + Intronic
939680807 2:145129630-145129652 TACTCTTCATTAAGTGGAAGTGG - Intergenic
939713572 2:145555059-145555081 TACTTTTCATTAAGTGGAAGTGG - Intergenic
939808253 2:146801827-146801849 TTGTTTTCAATAAGTAGAAAGGG + Intergenic
940140606 2:150487165-150487187 TTTTTTTTTTTAAGGGAAAACGG + Intronic
940352643 2:152706327-152706349 TTTTTTTCATTAGAAGAAAAAGG - Intronic
940780193 2:157925082-157925104 ATATTCTCCTTAAGTGAAAAAGG - Intronic
941087408 2:161133966-161133988 TGCTATTCATTAAGTGTAAGTGG - Intergenic
941128816 2:161620959-161620981 TACTGTTCGTTAAGTGAAAGTGG - Intronic
941144350 2:161824996-161825018 TACTACTCATTAAGTGAAAATGG - Intronic
941167712 2:162101224-162101246 TACTATTCATTAAGTGGAAGTGG + Intergenic
941256550 2:163239460-163239482 TACTATTTATTAAGTGAAAGTGG + Intergenic
941417559 2:165240943-165240965 TGCTTTTCTTTAAATGATAATGG - Intronic
941838179 2:170049293-170049315 TACTATTCATTAAGTGGAAGTGG + Intronic
941937866 2:171000554-171000576 CACTATTCATTAAGTGAAAGTGG + Intronic
942266654 2:174234177-174234199 TACTATTCACTAAGTGAAAGTGG - Intronic
942279560 2:174346367-174346389 TGCTTTTTTTTAAGTGAAGAAGG + Intergenic
942468248 2:176231436-176231458 GTCTTTTCCTTATTTGAAAAGGG - Intergenic
942709508 2:178817278-178817300 TTTATTTCTTTAAGAGAAAAGGG + Intronic
942738047 2:179139284-179139306 TTTTTTTCATAAAGAGGAAAAGG - Intronic
942915567 2:181301844-181301866 TTTCTTTCATAAACTGAAAATGG - Intergenic
942916145 2:181309588-181309610 TTATTTGTATTAAGTCAAAAAGG - Intergenic
943699038 2:190970235-190970257 TTCTTTGCTTTAAGTGTAACTGG - Exonic
943724643 2:191240904-191240926 TGCTACTCATTAAGTGGAAATGG + Intergenic
943788487 2:191905430-191905452 TCCTTTACATTGAGTGAAACAGG - Intergenic
943801697 2:192067956-192067978 TTCATTTCAGTAAGTGACATGGG - Intronic
943849733 2:192703096-192703118 TACTATTCATTAAGTGGAAGTGG + Intergenic
943850703 2:192718682-192718704 TGCCTTTCATTATGTAAAAAGGG - Intergenic
944093582 2:195941722-195941744 TTCCTTTCTTGAAGTGCAAAAGG - Intronic
944285081 2:197940267-197940289 TTATTTTCATTAAGCAAAAAAGG - Intronic
944627457 2:201586062-201586084 TACTGTTCATTAAGTGGAAGAGG - Intronic
944891007 2:204117454-204117476 TTCTTTAAAATAAGTGAAACAGG + Intergenic
944901009 2:204216115-204216137 TACTGTTCATTAAGTGGAAGTGG - Intergenic
945146147 2:206740375-206740397 TACTATTCATTAAGTGGAAATGG + Intronic
945310233 2:208303534-208303556 TACTATTCATTAAGTGGAAATGG + Intronic
945751527 2:213791756-213791778 TCCTTTCCATTAAATGATAAGGG - Intronic
945766776 2:213990610-213990632 TACTATTCATTAAGTGGAAGGGG + Intronic
946098513 2:217297859-217297881 TACTATTCATTAAGTGGAAGTGG - Intronic
946376132 2:219309807-219309829 TTCTCTTCCTTAAGAAAAAATGG + Intergenic
946384087 2:219371304-219371326 TACTATTCATTAAGTGGAAGTGG + Intergenic
946504622 2:220285531-220285553 TACTATTCATTAAGTGGAAGTGG + Intergenic
946587913 2:221211119-221211141 TACTCTTCATTAAGTGGAAGTGG + Intergenic
946698733 2:222388185-222388207 TACTCTTCATTAAGTGGAAGTGG - Intergenic
946758624 2:222971665-222971687 TTTTTTTTTTTAACTGAAAAAGG + Intergenic
946857681 2:223968969-223968991 TACTATTCATTAAGTGGACACGG - Intergenic
946920051 2:224570170-224570192 TCCTTATCATTAACTGCAAATGG - Intronic
947019780 2:225662360-225662382 TTCTTTTCAGAATGTGGAAAGGG - Intergenic
947022995 2:225704322-225704344 TTCTTTTTATGAAATGAACATGG - Intergenic
947120580 2:226810605-226810627 TACTACTCATTAAGTGAAAGTGG + Intergenic
947558091 2:231116146-231116168 TTTTTGTCATTTAGTGGAAAAGG + Intronic
948003214 2:234585573-234585595 TATTTTTAATGAAGTGAAAATGG + Intergenic
948232602 2:236362429-236362451 TACTATTCATTAAGTGGAAGTGG - Intronic
948246877 2:236493998-236494020 TTTTTTTTCTTAAATGAAAATGG - Intronic
948422288 2:237867259-237867281 TACTTTTCATTAAGTGTAAGTGG + Intronic
948926440 2:241101699-241101721 TACTTTTCATTAAGAGGAAGCGG - Intronic
1168886336 20:1260913-1260935 TTCTATTCATTAAGTGGAAGTGG + Intronic
1169818059 20:9679126-9679148 TACTATTCATTAAGTGGAAGTGG - Intronic
1170034028 20:11971229-11971251 TACTATTCATTATGTGGAAATGG - Intergenic
1170132503 20:13036421-13036443 TTCTTTTCATTAAGTGGAAGTGG - Intronic
1170202411 20:13759844-13759866 TTTTTTTCATTAGGTGATGATGG - Exonic
1170304332 20:14921069-14921091 TTCTATACATTATGTAAAAATGG - Intronic
1170517869 20:17150342-17150364 TTCTTGTCCTTAATTGAAAGTGG - Intergenic
1170634814 20:18094960-18094982 TACTATTCATTAAGTGGAAGTGG - Intergenic
1170756019 20:19207902-19207924 TTCCTCTCATTTAGAGAAAAAGG + Intergenic
1171040310 20:21756765-21756787 TACTCTTCATTAAGTGGAAGTGG + Intergenic
1171126700 20:22608705-22608727 TTCTTTTCATTTATCGCAAAGGG + Intergenic
1171413720 20:24963546-24963568 TTGTTTTGTTTAAGAGAAAATGG + Exonic
1172382837 20:34511175-34511197 TTGCTTTCATTAACTAAAAATGG + Exonic
1172678568 20:36694065-36694087 TACTATTCATTAAGTGGAAGTGG + Intronic
1173194436 20:40902724-40902746 TTCTTTTAATTCTGTCAAAAGGG - Intergenic
1173212118 20:41042893-41042915 TACCATTTATTAAGTGAAAATGG + Intronic
1173558604 20:43985665-43985687 TTATTTTCAGTAAGGTAAAATGG + Intronic
1174059543 20:47822841-47822863 TACTCTTCATTAAGTGGAAGTGG - Intergenic
1175295325 20:57904342-57904364 TGCTATTGATTAAGTGGAAATGG - Intergenic
1175547875 20:59791003-59791025 TTCTTTTCATTAATTCACCAGGG + Intronic
1175731206 20:61354983-61355005 TGCTTTTCTTTATGGGAAAATGG - Intronic
1176042004 20:63070706-63070728 TTTGTTTCATTAAGTGGGAAAGG - Intergenic
1176697294 21:9994703-9994725 TTCTATTTTTTAAGTGAAAATGG - Intergenic
1176713950 21:10333417-10333439 TACTATTCATTAAGTGAAAGTGG - Intergenic
1176765033 21:13008035-13008057 TTCTCTTCAGTAAGTAAGAATGG - Intergenic
1176992524 21:15515195-15515217 TTCTCTTCAGTAACTGGAAAGGG + Intergenic
1177270671 21:18845523-18845545 TACTCTTCATTAAGTAAAAGTGG + Intergenic
1177345546 21:19863877-19863899 TACTATTCATTAAGTGAAAGTGG - Intergenic
1177492115 21:21840059-21840081 TACTATTCATTAAGTGGAAGTGG + Intergenic
1177644918 21:23888622-23888644 TTCCTTTTATCAAATGAAAATGG + Intergenic
1177946581 21:27478329-27478351 TACTATTCATTAAGTGGAAGTGG - Intergenic
1178069561 21:28948441-28948463 TTTTTTTCATTTAGTGGAGATGG + Intronic
1178563173 21:33658182-33658204 TACTATTCATTAAGTGGAAGTGG + Intronic
1178585769 21:33869291-33869313 TTCTTGCCATTATGTGAAGAAGG - Intronic
1178779274 21:35585581-35585603 TTCTTTGAATTAAGTGTTAAAGG + Intronic
1178868836 21:36354123-36354145 TACTGTTCATTAAGTGGAAGTGG + Intronic
1179429039 21:41306093-41306115 TTCTTATGATTGAGTGAAATGGG - Intronic
1179610135 21:42544942-42544964 TTCTCTTCCTTAACTGGAAAGGG + Intronic
1180208719 21:46280101-46280123 TTCTTCTCCTTCAGGGAAAAGGG + Exonic
1180212081 21:46301090-46301112 TTTTTTTTATTAACTCAAAAGGG + Intronic
1180939852 22:19652971-19652993 TCCTATTCATTAAGTGAAAGTGG + Intergenic
1181382692 22:22519570-22519592 TTGCTTCCTTTAAGTGAAAATGG - Intronic
1181563916 22:23722405-23722427 TTCTTTTCACAAAGGCAAAAGGG - Intergenic
1181780404 22:25188736-25188758 TCCTGTTCATTAAGTGGAAGTGG + Intronic
1181820782 22:25473834-25473856 TACTATTCATTAAGTGGAAGTGG + Intergenic
1182101258 22:27659129-27659151 TTCTGTGCATTAAGTGTGAATGG + Intergenic
1182286765 22:29253270-29253292 TTCTTTTTTTTAAGAGACAAGGG - Intronic
1183139069 22:35918900-35918922 TTATTTTCCTTAATTTAAAATGG - Intronic
1183201750 22:36389692-36389714 TTTTTTTAATTAGGTGAAAATGG - Intergenic
1183651771 22:39159486-39159508 TACTCTTCATTAAGTGGAAGTGG - Intergenic
1184351499 22:43946944-43946966 TTATTTTAGTTAGGTGAAAAAGG - Exonic
1185016800 22:48348117-48348139 TACTCTTCATTAAGTGGAAGTGG - Intergenic
1185214802 22:49592567-49592589 TTCTTTGCATTGAGTGATGATGG - Intronic
949217443 3:1586577-1586599 TCCTTTTAAATAAATGAAAATGG + Intergenic
949248856 3:1958522-1958544 TACTATTCATTAAGTGGAAGTGG - Intergenic
949278643 3:2319576-2319598 TACTTTTCATTAGGTGGAAGTGG - Intronic
949591851 3:5502972-5502994 TTCATATCCTTAAGTGAAGAGGG - Intergenic
949599234 3:5580416-5580438 GTCTTTCCTTAAAGTGAAAAGGG + Intergenic
949631030 3:5926698-5926720 TACTATTCATTAAGTGGAAGTGG - Intergenic
949995009 3:9609588-9609610 TACTATTCATTAAGTGGAAGTGG - Intergenic
950156953 3:10728656-10728678 TACTATTCATTAAGTGGAAGTGG - Intergenic
950571798 3:13804979-13805001 TACTATTCATTAAGTGCAAGTGG - Intergenic
950571804 3:13805170-13805192 TACTATTCATTAAGTGGAAGTGG - Intergenic
950734639 3:14996024-14996046 TTCTTTTCATTGAGTTATAAGGG + Intronic
950778932 3:15374510-15374532 TGACTTTCAGTAAGTGAAAATGG + Intergenic
951055521 3:18142553-18142575 TTCAATTCATTATTTGAAAAGGG - Intronic
951354768 3:21651388-21651410 TTATTTTCATTCAGCTAAAATGG + Intronic
951466918 3:23010966-23010988 TTGTTTTTATTACGTGAACATGG + Intergenic
951479705 3:23147080-23147102 CTTTTATCATTAACTGAAAATGG - Intergenic
951854637 3:27181378-27181400 TACTATTCATTAAGTGGAAGTGG + Intronic
951950012 3:28189678-28189700 TTCTATTCATTAAGTGGAAGTGG - Intergenic
952434191 3:33255918-33255940 TAATATTGATTAAGTGAAAAAGG + Intergenic
952648237 3:35688897-35688919 TTCTTTGTTTTAAGAGAAAAAGG + Intronic
952668572 3:35937945-35937967 TTCATTATATTAAGTGAAATAGG - Intergenic
953361178 3:42298288-42298310 TACTATTCATTAAGTGGAATTGG + Intergenic
953778756 3:45846670-45846692 TACTATTCATTAAGTGGAAGTGG + Intronic
953868601 3:46606561-46606583 TGCTATTTATTAAGTGGAAATGG + Intronic
953965541 3:47302527-47302549 TACTATTCATTAAGTGGAAGTGG + Intronic
955145126 3:56309967-56309989 TTTTTTTAAATAAGAGAAAAAGG + Intronic
955382539 3:58451397-58451419 CACTGTTCATTAAGTGGAAATGG + Intergenic
955612367 3:60771167-60771189 TTCTTTTCTGTCAGTGAACATGG + Intronic
955618439 3:60834549-60834571 TTCTTTTCATTCTCTTAAAAGGG + Intronic
955647350 3:61154251-61154273 TTCGGTTCATTTAGTGTAAATGG - Intronic
955660443 3:61293392-61293414 TACTATTCATTAAGTCAAAGTGG + Intergenic
955681583 3:61506933-61506955 TACTATTTATTAAGTGAAAGTGG - Intergenic
955754126 3:62210733-62210755 TACTATTCATTAAGTGGAAGTGG - Intronic
955959607 3:64326770-64326792 TACTATTCATTAAGTGGAAGTGG + Intronic
956206209 3:66757644-66757666 TACTATTCATTAAGTGGAAGTGG + Intergenic
956495004 3:69815469-69815491 TACTAATCATTAAGTGAAAGTGG - Intronic
956572148 3:70708878-70708900 TACTATTCATTAAGTGGAAGTGG + Intergenic
956770654 3:72523076-72523098 TTCTTTTCATTATGTGACTTGGG + Intergenic
956794541 3:72705812-72705834 TACTATTCATTAAGTGGAAGTGG - Intergenic
956877954 3:73481982-73482004 TTCTTTCCATTATGCGAAAATGG + Intronic
956970348 3:74516405-74516427 TACTATTCATTAAGTGGAAGTGG - Intronic
957011534 3:75011245-75011267 TTCAGGTCATTCAGTGAAAAAGG + Intergenic
957138030 3:76314633-76314655 TACTATTCCTTAAGTGAAAGTGG - Intronic
957181469 3:76884220-76884242 TCAATTTCATTAACTGAAAAAGG - Intronic
957235402 3:77582539-77582561 TTCTTTTGATAAAATGAGAAAGG + Intronic
957326139 3:78697398-78697420 TTATTTTCTTTAGATGAAAAAGG - Intronic
957390344 3:79558325-79558347 TACTGTTCATTAAGTGTAAGTGG - Intronic
957548724 3:81675990-81676012 TACTATTCATTAAGTGAAAGTGG - Intronic
957586387 3:82137863-82137885 TTTTTTCCATTAACAGAAAAGGG + Intergenic
958750878 3:98192412-98192434 TTCTTGTCATAAAGGGCAAATGG + Intronic
958914923 3:100038893-100038915 TTCTTTTTATTACATGCAAAAGG - Intronic
958964819 3:100547501-100547523 TACTATTCATTAAGTGGAAGTGG + Intronic
959146927 3:102557823-102557845 TACTATTCATTAAGTGGAAGTGG - Intergenic
959154565 3:102650739-102650761 TTCTTTTCATTCCTAGAAAAGGG + Intergenic
959235422 3:103715818-103715840 TACTATTCATTAAGTCAAAAAGG + Intergenic
959601129 3:108186847-108186869 TACTATTCATTAAGTGGAAGTGG - Intronic
959601341 3:108189922-108189944 TACTATTCATTAAGTGGAAGTGG + Intronic
959818022 3:110698969-110698991 TACTATTCATGAAGTGAAAGTGG + Intergenic
960433214 3:117595231-117595253 TTCTTTTTTTTAATTGAACAAGG - Intergenic
961348398 3:126280010-126280032 TACTATTCATTAAGTGGAAGTGG - Intergenic
961927343 3:130495113-130495135 TTGTTTTCATTAATTGACATGGG + Intergenic
962162652 3:133015213-133015235 TACTGTTCATTAAGTGGAAGTGG - Intergenic
962256572 3:133873956-133873978 TACTGTTCATTAAGTGAAAGTGG + Intronic
962697438 3:137963987-137964009 TTTCTGTCATTGAGTGAAAAGGG - Intergenic
963496407 3:146068159-146068181 TACTATTCATTAAGTGGAAGTGG - Intergenic
963775258 3:149432803-149432825 TACTATTCATTAATTGAAAGTGG + Intergenic
963867830 3:150381825-150381847 GTCTTTTCAATAAATGATAATGG + Intergenic
963940102 3:151088736-151088758 TCCTTTTGACTAAGTGAAACAGG + Intronic
964367232 3:155963384-155963406 TTCCTCCCATTAAATGAAAATGG + Intergenic
964371541 3:156005143-156005165 TTCTTCTGGTTAAGTGAATAAGG - Intergenic
964791711 3:160459434-160459456 TATTATTCATTAAGTGAAAGTGG - Intronic
965312323 3:167145421-167145443 ATCTTTTGATATAGTGAAAAAGG + Intergenic
965375096 3:167912911-167912933 TTTTTTTTTTTAAATGAAAAAGG - Intergenic
965453211 3:168864316-168864338 ATATTTTCATCAAGTGAAAGGGG - Intergenic
965644070 3:170861333-170861355 TTCTAGTTACTAAGTGAAAAAGG + Intergenic
965877710 3:173348090-173348112 TGCTATTCATTAAGTGGAAGTGG + Intergenic
965973998 3:174598445-174598467 TTTTTAAGATTAAGTGAAAATGG + Intronic
965977662 3:174644386-174644408 TACTTTTCATTAAGTGGAAGTGG + Intronic
966127549 3:176597224-176597246 TTACTATTATTAAGTGAAAATGG - Intergenic
966306255 3:178538492-178538514 TTAATTTCATTAAGGGTAAAAGG + Intronic
966699749 3:182835017-182835039 TACTATTCATGAAGTGGAAATGG + Intronic
966760502 3:183413818-183413840 TACTATTCATTAAGTGTAAGTGG + Intronic
966951218 3:184819931-184819953 TGCTTTTCATTACGTGTAAGTGG + Intronic
967429338 3:189363552-189363574 TACTCTTCATTAAGTGGAAGTGG - Intergenic
968784993 4:2614387-2614409 TTTATTTCATTAACTAAAAAAGG - Intronic
968840858 4:3004696-3004718 TCCTATTCATAAAGTGGAAATGG + Intronic
969200911 4:5605013-5605035 TACTGTTCATTAAGTGGAAGTGG - Intronic
969290443 4:6235659-6235681 TTGGTTTCCTTAGGTGAAAATGG + Intergenic
969324448 4:6432959-6432981 TTCTGTTCATTAAGTGGAAGGGG - Intronic
970127861 4:12834539-12834561 TGCTATTTATTAAGTGAAAGTGG - Intergenic
970758331 4:19452654-19452676 TATTTTTCATTAAGTTAAAGTGG + Intergenic
970766077 4:19550551-19550573 CTCTTCTCATAAAGTGCAAAAGG + Intergenic
970778993 4:19712771-19712793 TTCTATTTTTTAAGTGAAATAGG - Intergenic
970944004 4:21669067-21669089 TACTATGCATTAAGTGAAAGTGG - Intronic
971174042 4:24263709-24263731 TACTATTCATTAAGTGGAAGTGG - Intergenic
971345083 4:25804353-25804375 TTGCTTTCAGTGAGTGAAAAAGG - Intronic
971702121 4:29992064-29992086 TTCTTTTCATGAAAAGAAGAGGG + Intergenic
971796355 4:31233820-31233842 TACTATTCATTAAATGGAAATGG + Intergenic
971983836 4:33793470-33793492 TACTATCCATTAAGTGAAAGTGG - Intergenic
972166848 4:36297072-36297094 TACTATTCATTAAGTGGAAGTGG + Intronic
972393242 4:38632895-38632917 TACTGATAATTAAGTGAAAAAGG - Intergenic
972695044 4:41437091-41437113 TTGTTTTGTTTAAGTGAGAAAGG - Intronic
972897482 4:43641385-43641407 TACTATTTATTAAGTGGAAATGG - Intergenic
972913890 4:43852172-43852194 TACTATTCATTAAGTGGAATGGG + Intergenic
973079415 4:45971207-45971229 TACTTTTCCTTAAAGGAAAAAGG - Intergenic
973172832 4:47166438-47166460 TGCTATTTATTGAGTGAAAATGG - Intronic
973558276 4:52108166-52108188 TACTATTCATTAAGTGGAAGAGG - Intergenic
973564953 4:52175846-52175868 TACTCTTCATTAAGTGGAAGTGG + Intergenic
973797920 4:54447839-54447861 TTTTTTTTTTTATGTGAAAAGGG - Intergenic
973865861 4:55112311-55112333 TACTATTCATTAAGTGTAAGTGG - Intronic
974147283 4:57964510-57964532 TACTATTCATTAAGTGGAAGTGG + Intergenic
974220667 4:58966429-58966451 TTATATTTTTTAAGTGAAAATGG + Intergenic
974274359 4:59698117-59698139 TACTATTTATTAAGTGGAAATGG + Intergenic
974495736 4:62624373-62624395 TGCTATTCATTAAGTGGAAGTGG + Intergenic
974623172 4:64386317-64386339 TACTGTTCATTAAGTGGAAATGG + Intronic
974686977 4:65243053-65243075 TACTATTCATTAAGTGAAAGAGG + Intergenic
974735247 4:65922066-65922088 TATGTTTCATTAAGTGAGAATGG + Intergenic
974755747 4:66204870-66204892 TTTTTTTCCCTAAGAGAAAAGGG - Intergenic
975150125 4:71011847-71011869 ATTCTTTCATAAAGTGAAAATGG + Intronic
975540434 4:75504425-75504447 AACTGTTCATTAAGTGGAAATGG - Intronic
976006251 4:80434296-80434318 GTCCTTTCATTAAGGGAGAAGGG - Intronic
976069567 4:81225547-81225569 TTCTTTACAGCAACTGAAAAAGG - Intergenic
976169611 4:82289439-82289461 TTCTTGTTATTTTGTGAAAATGG + Intergenic
976213607 4:82694705-82694727 TACTATTCATTAAGTGGAAGTGG + Intronic
976276213 4:83281418-83281440 TTCCTATCAGTAAGTGAATACGG - Intronic
976426853 4:84913970-84913992 TACCATTCATTAAGTGAAAGTGG - Intronic
976429152 4:84943121-84943143 TACTGTTCATTAAGTGGAAGTGG - Intronic
976602903 4:86954755-86954777 TACTGTTCATTAAGTGGAAGTGG + Intronic
976737584 4:88326298-88326320 TACTATTCATTAACTGGAAATGG - Intergenic
976807480 4:89064181-89064203 AACTATTCAGTAAGTGAAAATGG + Intronic
976843194 4:89456073-89456095 TGCTTTTGTTTAAGTGAAATTGG - Intergenic
976883801 4:89962311-89962333 TATTATTCATTAAGTGAAAGTGG + Intergenic
977167619 4:93720704-93720726 TTTTTTCCATCAAGTCAAAAGGG + Intronic
977231371 4:94453997-94454019 TTCTTCTCATAAAGGGAAAATGG - Intronic
977338953 4:95733433-95733455 TACTATTCATCAAGTTAAAATGG + Intergenic
977406347 4:96604147-96604169 TTGTTTTCATTTTGTGATAAAGG + Intergenic
977541143 4:98320010-98320032 TACTATTCATTAAGTGGAAGTGG - Intronic
977677293 4:99762119-99762141 TTCTTTACATTATATGAACAGGG + Intergenic
977923910 4:102677136-102677158 TTCTTTCTATCAAGTAAAAATGG - Intronic
977974419 4:103247460-103247482 TTATTCTCATTAAATGCAAAGGG - Intergenic
978011799 4:103695430-103695452 TACTATTCATTAAGTGAAAGTGG - Intronic
978036965 4:104007240-104007262 GTCTTTTCACCAAGTGAAACCGG - Intergenic
978101488 4:104846892-104846914 TTCTTTTCATGAATTCCAAATGG - Intergenic
978536885 4:109771829-109771851 TTGTTTTCATTAGGATAAAAGGG + Intronic
978598568 4:110404452-110404474 TTCTATTCAGTAAGTGGAAGTGG + Intronic
978760201 4:112349152-112349174 TTCTATTCATTAATTGAATATGG + Intronic
979126177 4:116975345-116975367 TTCTTTTTAGTATATGAAAATGG - Intergenic
979557130 4:122061923-122061945 TACTATTCATTAAGTGGAAGTGG - Intergenic
979640527 4:123008474-123008496 TTCTGATCATAAAGTAAAAAAGG - Intronic
979816669 4:125114740-125114762 TACTGTTCATTAAGTGGAAATGG - Intergenic
980161126 4:129164289-129164311 TTCCTGTCATTATGTGAAAAAGG - Intergenic
980369896 4:131854887-131854909 TTCTATTTTTTAAGTGAAAATGG - Intergenic
980447431 4:132928711-132928733 CTATTTTCTTTTAGTGAAAACGG + Intergenic
980487532 4:133478593-133478615 TACTATTCATTAAGTGAAAATGG - Intergenic
980510889 4:133786156-133786178 TACCATTCATTAAGTGAAAGTGG + Intergenic
980643882 4:135616588-135616610 TACTGTTCATTAAGTGTAACTGG + Intergenic
980702422 4:136450077-136450099 TACTGTTCATTAATTGAAACTGG + Intergenic
980788495 4:137586859-137586881 TTCTTTTAAGATAGTGAAAATGG - Intergenic
980798490 4:137716179-137716201 TTTGTTTCATTTAATGAAAATGG - Intergenic
981198794 4:141953289-141953311 TATTATTCATTAAGTGAAACTGG + Intergenic
981295591 4:143127315-143127337 TACTATTCATTAAGTGGAAGTGG + Intergenic
981495474 4:145386921-145386943 TACTATTCATTAAGTGGAAGTGG + Intergenic
981522056 4:145672896-145672918 CACTTTTTATTAAGTGAAATTGG + Intergenic
981602409 4:146505273-146505295 TACTATTCATTAAGTGGAAATGG - Intronic
981633581 4:146849659-146849681 TTTTTTTTTCTAAGTGAAAAGGG - Intronic
982111532 4:152060907-152060929 TACTTTTCATCAAGTGTAAGTGG + Intergenic
982385998 4:154803307-154803329 TAATTTTAAGTAAGTGAAAAAGG - Intronic
982425420 4:155253065-155253087 TAGTATTCATTAAGTGGAAATGG + Intergenic
982768676 4:159376098-159376120 TACTATTCATTAAGTGGAAGTGG - Intergenic
982815834 4:159883279-159883301 TACTATTCATTAAGTGGAATTGG - Intergenic
982952490 4:161717184-161717206 GTCTTTTTATTAAGGGAAACTGG + Intronic
983005410 4:162478477-162478499 TTCTTTTAATTCTGTGGAAAAGG + Intergenic
983039728 4:162911069-162911091 TGCTATTCATTAAGTGGAAGTGG - Intergenic
983279108 4:165658358-165658380 TACTATTCATTAAGTGGAAGTGG + Intergenic
983283311 4:165708328-165708350 ATATGTTCATTAAGTGAAAATGG - Intergenic
983812404 4:172078735-172078757 TTCTTGTCTTTGAGGGAAAAGGG + Intronic
983833084 4:172355561-172355583 TTCTTTTCTTTTATTGTAAAAGG + Intronic
983978193 4:173962760-173962782 TTCTATTCATTAAGTAAAAGTGG - Intergenic
984019691 4:174470173-174470195 TACTATTCATTAAGTGGAAGTGG + Intergenic
984221619 4:176984591-176984613 TTCTTTGAAATAAATGAAAATGG + Intergenic
984249777 4:177318060-177318082 TTCTTTTCATAAACTGTACATGG + Intronic
984330218 4:178305569-178305591 TTATTTTGAATAAGTGATAAGGG - Intergenic
984337650 4:178413925-178413947 TACTGTTCATTAAGTGTAAATGG - Intergenic
984343768 4:178492783-178492805 TTCTTTTAAATAAAGGAAAAAGG + Intergenic
984375733 4:178926571-178926593 TACTATTCATTAAGTGGAAGTGG + Intergenic
984394778 4:179182159-179182181 TTCTTGTCACTAACTCAAAAAGG - Intergenic
984419808 4:179506779-179506801 GACTTTTCATTAAGTGGAAGTGG + Intergenic
984534924 4:180962701-180962723 TACTTTTCGTTAAGTGGAAGTGG + Intergenic
984675806 4:182546082-182546104 TACTGTTCATTAAGTGGAAGTGG + Intronic
984739634 4:183148422-183148444 TTCTTTACATTATATTAAAATGG - Intronic
984782380 4:183537638-183537660 TACTATTCATTAAGTGGAAGTGG + Intergenic
984868754 4:184308935-184308957 TTATATTCATTAAGTAGAAATGG + Intergenic
985042763 4:185908184-185908206 TTCTTTTTATTAAGTTAGATGGG - Intronic
985263318 4:188135385-188135407 ATCTATTCACTAAGTGAAAGCGG - Intergenic
985771046 5:1811043-1811065 GACTTTTCATTAAGTGGAAGTGG - Intronic
986102072 5:4621856-4621878 TTATTTTCATTTTTTGAAAATGG + Intergenic
986529373 5:8719609-8719631 TTTTTTTTATTAAGCTAAAAAGG - Intergenic
986843558 5:11726176-11726198 TTCTTTTCATACTGTGAAAATGG + Intronic
986929395 5:12798681-12798703 ATCTTTACATTAACTGAGAAGGG + Intergenic
986982963 5:13470054-13470076 TTCTTTATATTTAGTAAAAATGG - Intergenic
987320913 5:16768518-16768540 TTCTTTTTAAAAAGAGAAAATGG + Intronic
987640397 5:20604933-20604955 CCCTTTTGATTAACTGAAAATGG - Intergenic
987728924 5:21742393-21742415 TACTATTCATTAAGTGAAAATGG - Intergenic
987843473 5:23252124-23252146 TACTATTCATTAAGTGGAAATGG - Intergenic
988121134 5:26964360-26964382 TTCTATTCATTCATTGAGAAAGG - Intronic
988164734 5:27571998-27572020 CACTATTCATTAAGTGCAAATGG + Intergenic
988271708 5:29025723-29025745 TTTTTTATGTTAAGTGAAAAAGG - Intergenic
988296019 5:29363315-29363337 TACTATTCATTAAATGGAAATGG + Intergenic
988531540 5:32031858-32031880 GTTTTTTCATTATGTGAAATAGG - Intronic
988539191 5:32094013-32094035 TACTATTCATTAAGTGGAAGTGG + Intronic
988573461 5:32395743-32395765 TACTATTCATTAAGTGGAAGTGG - Intronic
988737496 5:34037455-34037477 TTCTTTTCTTTAATAAAAAATGG + Intronic
989051714 5:37327017-37327039 TACTATTCATTAAGTGGCAATGG - Intronic
989085354 5:37670794-37670816 TTCATTTCAGTGAGGGAAAATGG - Intronic
989129302 5:38089539-38089561 GTCTTTTCAATAAATGATAATGG + Intergenic
989223123 5:38992231-38992253 TTTTTTCAATTAACTGAAAAAGG + Intronic
989416862 5:41188591-41188613 TTTTTTGCATTATGTGAGAAAGG - Intronic
990071826 5:51791364-51791386 TTCTTTGACATAAGTGAAAATGG + Intergenic
990146627 5:52768318-52768340 TTCATTTCATTATATGACAAAGG - Intergenic
990169982 5:53037274-53037296 TTCTTTTCCTCCAGTGAAACTGG - Intronic
990186693 5:53217897-53217919 TACTATTCATTAAGTGGAAATGG + Intergenic
990205481 5:53424550-53424572 TTCTTTTTCTTAAGACAAAAAGG + Intergenic
990403107 5:55459912-55459934 TGCTATTCAGTAAGTGGAAATGG - Intronic
990847533 5:60160102-60160124 TACCATTCATTAAGTGGAAATGG - Intronic
990974325 5:61544392-61544414 CTCTGTTCTTTAAGTTAAAAAGG - Exonic
991158929 5:63472242-63472264 TTCATTTCATTTTTTGAAAATGG + Intergenic
991175680 5:63685222-63685244 TACAATTCATTAAGTGGAAATGG - Intergenic
991358112 5:65791051-65791073 TTCTCTTCATAAAGGTAAAAGGG + Intronic
991982590 5:72248658-72248680 TTTTTTTTTTTAAATGAAAATGG - Intronic
992284663 5:75221782-75221804 TACTATTCATTAAGTGCAAGTGG - Intronic
992485983 5:77195790-77195812 TACTATTCATTATGTGAAAGTGG + Intergenic
992486545 5:77202451-77202473 TACTATTCATTAAGTGAAAATGG - Intergenic
992537374 5:77721361-77721383 TTTTGTTCATTAAGTCAAAATGG + Intronic
992731950 5:79680459-79680481 TTCTTTTCCTTAACAGAATAAGG - Intronic
992956126 5:81910186-81910208 TATTATTCATTAAGTGAAAGTGG - Intergenic
993076754 5:83241865-83241887 TACTATTCATTAAGTGGAAGTGG + Intronic
993109631 5:83641371-83641393 CTCTTTACAGTAAGTAAAAAAGG + Exonic
993302475 5:86227709-86227731 TACTATTCATTAAGTAAAAGTGG - Intergenic
993327441 5:86559558-86559580 TACTATTCATTAAGTGAAAGTGG - Intergenic
993456568 5:88133917-88133939 TACTATTTATTAAGTGGAAATGG + Intergenic
993462434 5:88200227-88200249 TTCTTTTTATTAAGTCATGAGGG + Intronic
993614969 5:90099621-90099643 TTTTTTTCATTAAAGGAAAAAGG - Intergenic
993670669 5:90757789-90757811 TTTTTATCAGTAAGTGGAAAAGG + Intronic
993952153 5:94189505-94189527 GTCTTTTCAATAAGTGATACTGG - Intronic
993989613 5:94639729-94639751 TACTATTCATTAAGTGAAAGTGG + Intronic
994013090 5:94930927-94930949 TTATTTTAATAAAATGAAAAAGG - Intronic
994282601 5:97923552-97923574 TTTTTTTTCTTTAGTGAAAATGG + Intergenic
994805295 5:104439427-104439449 TACTATTTATTAAGTGAAAGTGG + Intergenic
995035142 5:107525638-107525660 TACTATTCATTAAGTGGAAGTGG + Intronic
995214722 5:109582275-109582297 TACTATTCATTAAGTGGAAGTGG + Intergenic
995251968 5:110003878-110003900 TACTATTCATTAAGTGAAAGTGG - Intergenic
995791005 5:115886456-115886478 TACTCTTCATTTAGTGGAAATGG - Intronic
995807134 5:116065616-116065638 TACTATTCATTAAGTGGAAGTGG + Intergenic
996110999 5:119566701-119566723 TTCCCTTCTTTAAGTGAGAAAGG - Intronic
996342021 5:122449416-122449438 TTACTTTCATTAAATAAAAAAGG - Intronic
996628502 5:125599735-125599757 TACTATTCATTAAGTGAAAGTGG + Intergenic
996645385 5:125808814-125808836 GTCTTTTCAGTAAGTGATATTGG + Intergenic
996811770 5:127523715-127523737 TTCTATTCTTTAAATTAAAAAGG - Intronic
996886423 5:128360406-128360428 ATCTTTTCAGTAGGTGAGAAGGG - Intronic
997129397 5:131262238-131262260 TTATTCTCATTCAGTGAAATAGG + Intronic
997837041 5:137203432-137203454 CTCATCTCATGAAGTGAAAAAGG + Intronic
998490175 5:142539677-142539699 TACTATTCATTAAGTGGAAAAGG - Intergenic
998919412 5:147051602-147051624 TTCTTTTCCTAAAGGGACAAGGG - Intronic
999014812 5:148090501-148090523 TTTTATGCATTATGTGAAAAGGG + Intronic
1000013396 5:157255223-157255245 AACTTTTCCTTAAGTAAAAATGG + Intergenic
1000161905 5:158606027-158606049 TACTGTTCATTAAGTGGAAGTGG + Intergenic
1000177280 5:158769805-158769827 TTCTTTTCTTTGTGTGTAAATGG + Intronic
1000204258 5:159042677-159042699 TTTTTTTAAGTAACTGAAAAAGG - Intronic
1000266066 5:159639600-159639622 TACTATTCATTAAGTGGAAGTGG + Intergenic
1000484746 5:161827209-161827231 TTCTTTTCAAGTAGTAAAAAAGG - Intergenic
1000752490 5:165114014-165114036 TACTATTCATTAAGTGGAAGTGG - Intergenic
1000873523 5:166606307-166606329 TACTATTCATTAAGTGGAAGTGG - Intergenic
1000924844 5:167180766-167180788 TACTATTCATTAAGTGGAAATGG + Intergenic
1000930227 5:167242611-167242633 TACTATTCATTAAGTGAAAGTGG - Intergenic
1001068835 5:168565846-168565868 TTTTTTTTTTTAAGTGAAAGAGG - Intronic
1001136250 5:169104946-169104968 TTCTTTTCTTGACATGAAAATGG - Intronic
1001285508 5:170420310-170420332 TGCTATTTATTAAGTGAAAGTGG - Intronic
1001383678 5:171320424-171320446 TACTGTACATTAAGTGAAAGTGG - Intergenic
1003013479 6:2448856-2448878 TTTTTTTCCCTAAGGGAAAAGGG - Intergenic
1003538541 6:6997890-6997912 TTTTTTTCTTTAAGTAGAAATGG + Intergenic
1003726233 6:8768004-8768026 TTCATTACATTAACAGAAAAAGG - Intergenic
1003781943 6:9439164-9439186 TACTATTCATTAAGTTGAAATGG + Intergenic
1003844910 6:10163123-10163145 CTCTTTTCATTCAGTGGAAGTGG - Intronic
1003947087 6:11085845-11085867 TACTATTCATTAAGTGGAAGTGG + Intergenic
1004091276 6:12504344-12504366 TTATTATCATTATGTGAAGATGG + Intergenic
1004433621 6:15568700-15568722 TACTATTCATTAAGTGGAAGTGG - Intronic
1004583994 6:16981874-16981896 TACTATTCATTAAGTGGAAGTGG + Intergenic
1004783476 6:18938930-18938952 TAGTTTTCTTTAAGTTAAAAAGG + Intergenic
1004813689 6:19288778-19288800 TTCTTGCCACTACGTGAAAAAGG - Intergenic
1004839991 6:19572290-19572312 TTCTTTGAGTTTAGTGAAAAAGG - Intergenic
1004918551 6:20355192-20355214 TACTATTCATTAAGTGAAAGTGG - Intergenic
1004976171 6:20969356-20969378 TACTATTCATTAAGTGGAAGTGG + Intronic
1006262917 6:32891870-32891892 TACTATTCATTAAGTGGAAGTGG + Intergenic
1006976947 6:38111593-38111615 TTCTCTTCCTTAAGTGAAAGTGG - Intronic
1007218254 6:40258295-40258317 TTGGTTTCTTTAATTGAAAATGG - Intergenic
1007465762 6:42050007-42050029 TTCTTTTAACTCAGTGAAACCGG + Intronic
1007585062 6:42984441-42984463 TTCTTTCCAATAAGAAAAAAAGG + Intergenic
1007732859 6:43959938-43959960 TACTATTCATTAAGTGAAAGTGG - Intergenic
1008055034 6:46937000-46937022 TGCCTCTCATTAAGTAAAAAGGG - Intronic
1008124056 6:47649013-47649035 TTCTATTCACTAAGTGGAAGTGG - Intergenic
1008265024 6:49414478-49414500 TACTATTCATTAAGTGAAAGCGG - Intergenic
1008586000 6:52950031-52950053 TACTATTCATTAAGTGGAAATGG - Intergenic
1008589893 6:52983589-52983611 TTCATTTCATTATGTGTAAAAGG + Intronic
1008680569 6:53867615-53867637 TACTTTTCATTAATTCAAATTGG - Intronic
1008742682 6:54628468-54628490 TACTATTCATTAAGTGGAAGTGG - Intergenic
1008792919 6:55260920-55260942 TTCTTTTCATTACTTCATAAAGG - Intronic
1008855849 6:56086524-56086546 TACTATTCATTAAGTGGAAGTGG + Intronic
1008933839 6:56968026-56968048 TTATTTTTATTAAGTGAAGGAGG + Intronic
1008945713 6:57094744-57094766 TTTTCTTCCTTAAGAGAAAATGG - Intronic
1008947472 6:57114424-57114446 TTTTTTGCTTTAAGTGATAACGG + Intronic
1009231968 6:61073556-61073578 TGCTATTCATTAAGTGGAAGGGG - Intergenic
1009901256 6:69810323-69810345 TACTATTAATTAAATGAAAATGG - Intergenic
1009938536 6:70261554-70261576 TTCTTCTCACTTAGAGAAAATGG + Intronic
1010175044 6:73018129-73018151 TTATTATCATTAAGTCAAAGAGG - Intronic
1010487197 6:76429521-76429543 TTCTTTTTTTTAATTGAAACAGG + Intergenic
1010547594 6:77176921-77176943 CTATTTTCTTTGAGTGAAAAAGG + Intergenic
1010575137 6:77520575-77520597 ATATTTTCATTAAATGTAAAAGG + Intergenic
1010828642 6:80503607-80503629 TACTATTCATTTAGTGAAAGTGG - Intergenic
1010845155 6:80697755-80697777 TTCAATTCATTAATTAAAAAGGG + Intergenic
1010906347 6:81494909-81494931 TTTTTTTCATTTATTGAAAGGGG + Intronic
1011046217 6:83086333-83086355 TACTGTTCATTAAGTGGAAGTGG + Intronic
1011778685 6:90761816-90761838 TACTATTCATTAAGTAAAAATGG + Intergenic
1011960142 6:93078618-93078640 TTCTTTTCAATACCTGAAAAAGG - Intergenic
1012012408 6:93805972-93805994 TACTATTCATTAAGTAGAAATGG - Intergenic
1012016285 6:93856344-93856366 TTCCTGTCATTAAGTGAAGAAGG + Intergenic
1012107196 6:95178052-95178074 TACTATTCATTAAGTGGAAGTGG + Intergenic
1012488426 6:99748727-99748749 TACTATTCATTAAGTGGAAGTGG + Intergenic
1012525710 6:100175488-100175510 TTCATCACATTAAGTGAGAATGG + Intergenic
1012865809 6:104616639-104616661 TTCTTTTCTTTAGGTGGAGAGGG - Intergenic
1012938292 6:105391068-105391090 TTTTTTTAATTAAGAGACAAAGG + Intronic
1012969072 6:105707149-105707171 TACTGTTCATTAAGTGGAAATGG - Intergenic
1013363311 6:109414997-109415019 TACTATTCATTAAGTGGAAGTGG + Intronic
1013755608 6:113458084-113458106 ATTTTTTCCTTAAGTGGAAATGG - Intergenic
1013859298 6:114615428-114615450 TTGCTTTCATTAAGTACAAATGG - Intergenic
1014061539 6:117077575-117077597 TACTATTAATTAAGTGAGAATGG - Intergenic
1014175167 6:118324343-118324365 TTCATTTGCTTAACTGAAAAGGG - Intergenic
1014242901 6:119037825-119037847 TGCTTTTCAAGAAGAGAAAAAGG - Intronic
1014327933 6:120022784-120022806 TACTATTCATTAAGTGGAAGTGG - Intergenic
1014554270 6:122826689-122826711 TACTATTCATTAAGTGCAAATGG - Intergenic
1014645883 6:123972059-123972081 TACTATTCATTAAGTGGAAATGG - Intronic
1015118990 6:129680757-129680779 TGCTTTTCCTTAACTGAAAAAGG + Intronic
1015200834 6:130578390-130578412 TACTATTCATTAAGTGGAAGTGG + Intergenic
1015233996 6:130949853-130949875 TACTATTCATTAAGTGGAAGTGG - Intronic
1015740121 6:136445011-136445033 CTCGTTTCATTATATGAAAATGG - Intronic
1016688841 6:146912508-146912530 TCCTTTTCCTAAAATGAAAAAGG + Intergenic
1016833881 6:148457825-148457847 TTCTTGTCATCATGTGAAGAAGG - Intronic
1016862180 6:148731758-148731780 TACTATTCATTAAGTGGAAGTGG + Intergenic
1017105344 6:150882570-150882592 TTCTTTTCATCATGTGTACAAGG - Intronic
1017178448 6:151526797-151526819 TTCTTTTCATTGAGTGGGCAGGG - Intronic
1017259847 6:152373194-152373216 TTTTTGTCAGAAAGTGAAAATGG - Exonic
1017602175 6:156095551-156095573 TACTATTCATTAAGTGGAAGTGG - Intergenic
1017608586 6:156159673-156159695 TACTCTTCATTAAGTGGAAGTGG + Intergenic
1017652154 6:156593537-156593559 TACTATTCATTAAGTGGAAGGGG - Intergenic
1017691115 6:156966077-156966099 TTCTTTTCAATAAGTGGGACTGG + Intronic
1018236902 6:161735343-161735365 TACTCTTCATTAAGTGGAAGTGG - Intronic
1019016969 6:168886885-168886907 TTCTTTTTTTTAAGAGGAAAAGG - Intergenic
1019021806 6:168924962-168924984 TTTTTTTTATTAATTGAAATTGG + Intergenic
1020398387 7:7745136-7745158 TACTATTCATTAAGTGGAAGTGG + Intronic
1020597792 7:10231060-10231082 CTCTTTTCATGAAGGAAAAAAGG - Intergenic
1020705225 7:11536027-11536049 ATCTTTTCAATAACTTAAAATGG - Intronic
1020970950 7:14937841-14937863 TACTATTCATTAAGTGAAAGTGG - Intronic
1021211921 7:17864027-17864049 GGCTTTTCATGAAGTCAAAAGGG - Intronic
1021290652 7:18840104-18840126 TTCTTTTCTTGAAATTAAAAGGG - Intronic
1021292051 7:18858128-18858150 TTATTTTCATTTTTTGAAAAGGG - Intronic
1021407932 7:20295398-20295420 TACTATTCATTAAGTGGAAGTGG - Intergenic
1021490457 7:21215092-21215114 TTCCTTTCACTAAGGGGAAATGG - Intergenic
1021537081 7:21717568-21717590 GTCTTTTCATTAAGGTAAAATGG + Intronic
1021834273 7:24652591-24652613 TTTTTTTTTTTAAATGAAAAGGG + Intronic
1022306717 7:29153527-29153549 TACTGTTCATTAAGTGGAATTGG - Intronic
1022349773 7:29557044-29557066 TTGTCTTCACAAAGTGAAAAGGG - Intergenic
1022400744 7:30034601-30034623 TACTGTTCATTAAGTGGAAGTGG + Intronic
1022550600 7:31235720-31235742 TTTCTTTCTTTAATTGAAAATGG + Intergenic
1022792254 7:33700754-33700776 TCCTTTGCATTAACTAAAAATGG - Intergenic
1023115713 7:36860014-36860036 TACTATTCATTAAGTGGAAGAGG - Intronic
1023283942 7:38599384-38599406 TACTATTCATTAAGTGGAATTGG - Intronic
1023316976 7:38948186-38948208 TACTATTCATTAAGTGGAAGTGG - Intergenic
1023375486 7:39551269-39551291 TACTCTTCATTAAGTGGAAGTGG - Intergenic
1023386719 7:39665271-39665293 TACTAGTCATTAAGTGAAAGTGG - Intronic
1023403254 7:39806058-39806080 TTTTTTTAATTAAAGGAAAAAGG + Intergenic
1023769738 7:43545721-43545743 TTCTATTCATTGAGTGGAAGTGG + Intronic
1024690848 7:51801566-51801588 TACTATTCATTAAGTGGAAGTGG - Intergenic
1024850584 7:53711180-53711202 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1025235363 7:57231151-57231173 TACTCTTCATTAAGTGGAAGTGG + Intergenic
1025909103 7:65813095-65813117 TTCTATTTATTAATTGACAAAGG + Intergenic
1027007831 7:74710724-74710746 TTTTTAATATTAAGTGAAAAGGG + Intronic
1027242328 7:76339746-76339768 TACTCTTCATTAAGTGGAAGTGG - Intronic
1027291624 7:76718969-76718991 TTCATTACATTAAGTGTAAATGG - Intergenic
1027356404 7:77360337-77360359 TTGTTTTCATTGAGTAAATATGG - Intronic
1027509544 7:79062510-79062532 TTATTTTCATTGAATGGAAATGG + Intronic
1028007669 7:85596661-85596683 TTCTTTTCATCAAGTCACATGGG + Intergenic
1028030473 7:85905720-85905742 TACTTTTCATTAAGTGGAAGTGG - Intergenic
1028302545 7:89218820-89218842 TACTATTCATTAAGTGGAAGTGG + Intronic
1028307720 7:89287045-89287067 TACTATTCATTAAGTGGAAGTGG - Intronic
1028490751 7:91408882-91408904 ATCTTTTCTTCATGTGAAAAGGG - Intergenic
1029175040 7:98658667-98658689 TTCGTTTTTTTAAGTGGAAATGG + Intergenic
1029684313 7:102135330-102135352 TTCCGTTCATTAAGTGGAAGTGG + Intronic
1029947103 7:104544250-104544272 TTATTTTCATTTACTAAAAATGG - Intronic
1030002708 7:105082519-105082541 TACTGTTCATTAAGTGGAAGTGG + Intronic
1030207226 7:106962725-106962747 TTGTTCTCATTTTGTGAAAATGG + Intergenic
1030311140 7:108070566-108070588 TTATATTCATTAAGTGGAAGTGG - Intronic
1030507457 7:110442778-110442800 TTCTTCTCAGTAAATGACAAGGG + Intergenic
1030615698 7:111735911-111735933 TCCATCCCATTAAGTGAAAATGG - Intronic
1030791044 7:113729447-113729469 TACTACTCATTAAGTGAAAGTGG - Intergenic
1030993382 7:116328765-116328787 TTATCTTCATTAGGTGAAAAAGG - Intronic
1031050536 7:116940406-116940428 TACCATTCATTAAGTGAAAGTGG - Intergenic
1031060685 7:117048089-117048111 TACTGTTCATTAAGTGGAAGTGG + Intronic
1031209772 7:118808245-118808267 TACTATTCATTAAGTGGAAGTGG + Intergenic
1031565475 7:123291825-123291847 TACTATTCACTAAGTGAAAGTGG + Intergenic
1031674957 7:124598502-124598524 TTCTTATCATTGAATTAAAAGGG - Intergenic
1032292770 7:130604024-130604046 AACTATTCATTAAGTGAAAGTGG + Intronic
1032662306 7:133998385-133998407 TTCTTTTCTTTAAGATAAAATGG + Intronic
1032730273 7:134634839-134634861 TACTATTGATTAAGTGGAAATGG - Intergenic
1032940619 7:136785696-136785718 TACTATTCATTAAGTGGAAGTGG + Intergenic
1033006169 7:137566610-137566632 CTCTTTTCATCATGTGAATAAGG - Intronic
1033286840 7:140048763-140048785 TACATCTAATTAAGTGAAAAAGG + Intronic
1033922188 7:146407879-146407901 TTATATTCATTAAGTGAAAGTGG - Intronic
1033992377 7:147304510-147304532 TTGTTATCATTAAAAGAAAAAGG + Intronic
1034012209 7:147541789-147541811 TTCTTTTCCCTTAGTGAACACGG - Intronic
1034857009 7:154559896-154559918 TTATTTTTTTTAAGAGAAAAAGG - Intronic
1036056581 8:5261831-5261853 TTATTTTAACCAAGTGAAAATGG - Intergenic
1036197856 8:6736437-6736459 TTTGTTTCTTTAAGTGATAAAGG + Intronic
1036216707 8:6885766-6885788 TACTCTTCATTAAGTGGAAGAGG - Intergenic
1036389891 8:8316337-8316359 TTATTTACTTGAAGTGAAAAAGG + Intergenic
1036467374 8:9013313-9013335 TTTTTTTTTTTAAGTGAGAATGG - Intronic
1036494376 8:9256197-9256219 TACTATTTATTAAGTGGAAATGG + Intergenic
1036532919 8:9612942-9612964 TACTATTCATTAAGTGGAAGTGG + Intronic
1037702885 8:21290882-21290904 TTTTTTTCCTCAGGTGAAAAGGG + Intergenic
1037749273 8:21669706-21669728 TACTCTTCATTAAGTGGAAGTGG - Intergenic
1038123762 8:24647738-24647760 TTCTTTTTATAATTTGAAAAGGG - Intergenic
1038254570 8:25939491-25939513 TTCATTACATTAATTGTAAAAGG - Intronic
1038571063 8:28663275-28663297 TTCTTTTTATAAAGTAGAAAAGG + Intronic
1039074282 8:33675215-33675237 TACTATTCATTAAGTGGAAGTGG + Intergenic
1039128079 8:34227463-34227485 TTCTTCTCATCTGGTGAAAACGG + Intergenic
1039186137 8:34918399-34918421 TGCTATTCATTAAGTGGAAGTGG - Intergenic
1041093031 8:54321044-54321066 TTCTTTTAATTAAGTTAGCATGG - Intergenic
1041360317 8:57046123-57046145 TACTATTCATTAAGTGGAAATGG + Intergenic
1041458871 8:58090120-58090142 TACTATTCATTAAGTGGAAGTGG - Intronic
1041614967 8:59895701-59895723 TACTATTAATTAAGTGAAAATGG - Intergenic
1041835799 8:62213654-62213676 TGCTATTCATTAAGTGGAAGTGG + Intergenic
1042076662 8:65003176-65003198 TACTATTCATTAAGTGGAAATGG + Intergenic
1042365489 8:67931691-67931713 TTCTTTTCTGTAATTCAAAAAGG - Intergenic
1042465279 8:69122677-69122699 TTTTTTTTGTTATGTGAAAAAGG + Intergenic
1043132059 8:76473727-76473749 TATATTTCATTAAGTGAAAGTGG - Intergenic
1043281878 8:78478437-78478459 TTCTTTTCATTAAGACAAAAAGG + Intergenic
1043718528 8:83513653-83513675 ATATGTTCCTTAAGTGAAAATGG - Intergenic
1043782423 8:84352754-84352776 TGTGTTTCATTATGTGAAAAAGG - Intronic
1043962946 8:86438180-86438202 TACTGTTCATTAAGTAAAAGTGG + Intronic
1044489039 8:92790259-92790281 TTCTATTCGCTAAGTGAAAGTGG + Intergenic
1044642710 8:94401397-94401419 TACTATTCATTAAGAGGAAATGG - Intronic
1044684263 8:94811981-94812003 TTCCTTCCATTAGGTGAATAAGG + Intergenic
1044752274 8:95427888-95427910 TTCTGTTTAATGAGTGAAAAGGG - Intergenic
1045336847 8:101212584-101212606 TAATATTCATTAAGTGAAAGTGG - Intergenic
1045852617 8:106720943-106720965 TTCTTATCATGAAGTCAAAATGG + Intronic
1045894576 8:107199337-107199359 TTGTTTTCAGTTAGAGAAAATGG + Intergenic
1045910298 8:107399697-107399719 TTCTTTTAATGGAGTGGAAAGGG - Intronic
1046132487 8:109984041-109984063 TTTTTTTTTTCAAGTGAAAATGG + Intergenic
1046186118 8:110721757-110721779 TTCTTTCCTTTTAGTAAAAAGGG + Intergenic
1046224430 8:111259527-111259549 TTCCTTTCCTTATTTGAAAATGG - Intergenic
1046436626 8:114197768-114197790 CACTTTACATAAAGTGAAAATGG + Intergenic
1046479344 8:114794564-114794586 TGCTTTTCATTGAGAGAATATGG + Intergenic
1046765619 8:118066257-118066279 TACTATTCATTAAGTGCAAGTGG - Intronic
1046778146 8:118185817-118185839 TTATTTTCATTAATAGAAAGTGG + Intergenic
1047291610 8:123536243-123536265 TCCTTTTCATTCAGGGAAACAGG + Intronic
1047320265 8:123772888-123772910 TTCTAGTCATTAAGTGGAGATGG + Intronic
1047868025 8:129050384-129050406 TACTATTCATTAAGTAAAAGAGG - Intergenic
1047902454 8:129438249-129438271 TACTATTCATTAAGTGGAAGTGG - Intergenic
1048033525 8:130655011-130655033 TACATATTATTAAGTGAAAAAGG + Intergenic
1048353299 8:133633271-133633293 TTCTTTTTAATAAGTGTAGAAGG - Intergenic
1048462390 8:134632212-134632234 TACTGTTCATTAAGTGGAAGTGG - Intronic
1048480098 8:134781817-134781839 TACACTTCATTAAGTGAAAGTGG - Intergenic
1048484818 8:134837274-134837296 TCCTCTTCATTAAGTGGAAGTGG - Intergenic
1048505318 8:135015490-135015512 TTCTTGTCATTAACTTTAAAAGG - Intergenic
1048657100 8:136552417-136552439 TTCTTTAGTTTAAGAGAAAAAGG - Intergenic
1048657577 8:136558203-136558225 TTATTTTGATGAAGTGAGAAAGG - Intergenic
1048906683 8:139095786-139095808 TCCTTTTCTTAAAGGGAAAAAGG - Intergenic
1048906871 8:139096955-139096977 TCCTTTTCTTAAAGGGAAAAAGG - Intergenic
1049012896 8:139899431-139899453 TCCTATTCATGAAGTGAAAGTGG + Intronic
1049098801 8:140564564-140564586 TACTTTTCATTAAGTGGAAGTGG - Intronic
1049831282 8:144702699-144702721 TAATATTCATTAAGTGAAAGTGG + Intergenic
1050045180 9:1535926-1535948 GTCTTTTCATTAAGTTCTAAGGG + Intergenic
1050972946 9:11900121-11900143 TACTATTCATTAAGTGGAAGTGG + Intergenic
1051108414 9:13607157-13607179 TTATTTTTTTTAATTGAAAACGG + Intergenic
1051137105 9:13934793-13934815 TTTTTTTCCTTAAGTAAATAAGG - Intergenic
1051318101 9:15865576-15865598 TACTATTCATTAAGTGGAAGTGG - Intronic
1051551075 9:18330041-18330063 CTCATTTCATCATGTGAAAAAGG - Intergenic
1051666103 9:19468132-19468154 TTATTTTCTTTAATTGAAAGGGG + Intergenic
1051669549 9:19495785-19495807 TTCTTTTCAGTATGTGCAGAAGG + Intergenic
1051782684 9:20707614-20707636 AACTTTTCATTAAGTGGAAGTGG + Intronic
1051840452 9:21391900-21391922 TATTATTCATTAAGTGGAAATGG + Intergenic
1052039502 9:23721749-23721771 TACTGTTCATTAAGTGGAAGTGG - Intronic
1052494287 9:29207952-29207974 TTATTTTCATTATGTGAATTAGG - Intergenic
1052590446 9:30486757-30486779 TTATTTTCATTTACTGAAATAGG + Intergenic
1052617964 9:30867104-30867126 TACTATTCATTAAATGAAAGTGG - Intergenic
1052994500 9:34544003-34544025 TACTATTCATTAAGTGGAAGTGG + Intergenic
1053038905 9:34852129-34852151 TACTATTCATTAAGTGGAAGTGG - Intergenic
1053110790 9:35457997-35458019 TGCTGTTCATACAGTGAAAAAGG - Intergenic
1053634285 9:39980541-39980563 TTCTATTTTTTAAGTGAAAATGG - Intergenic
1053771464 9:41482951-41482973 TTCTATTTTTTAAGTGAAAATGG + Intergenic
1054209602 9:62270156-62270178 TTCTATTTTTTAAGTGAAAATGG + Intergenic
1054315389 9:63578812-63578834 TTCTATTTTTTAAGTGAAAATGG - Intergenic
1054920438 9:70537664-70537686 TCCATTTCATTGAGGGAAAAGGG - Intronic
1055173372 9:73288030-73288052 TATTTTTCCTTAAGTTAAAATGG - Intergenic
1055280486 9:74668674-74668696 TCCTGTTCATTAAGTGGAAGTGG + Intronic
1055339955 9:75270734-75270756 TTCTTTGCCTTAAGTGGAACAGG - Intergenic
1055413750 9:76060393-76060415 TAGTATTCATTAAGTGGAAATGG + Intronic
1056717101 9:89040798-89040820 TTATTTTTGTTAAGTCAAAATGG + Intronic
1057668219 9:97063496-97063518 TTTTCTTCATTACCTGAAAAGGG - Intergenic
1057954225 9:99394895-99394917 TTTTTTTTTTTAAATGAAAAAGG - Intergenic
1057980976 9:99662938-99662960 TACTATTCATTAAGTGGAAGTGG + Intergenic
1058089088 9:100783569-100783591 TACTATTCACTAAGTGGAAATGG - Intergenic
1058161566 9:101575579-101575601 TTCTTTGCATTAAATGAGAAAGG + Intronic
1058287283 9:103194145-103194167 TGCATTTGACTAAGTGAAAAAGG + Intergenic
1058333423 9:103794233-103794255 TTCCTTTTATTACGTGCAAAAGG + Intergenic
1058639643 9:107070476-107070498 TTCATGTCATTAAATGAACAAGG - Intergenic
1058660974 9:107268466-107268488 TACTATTCATTAAGTGAAAGTGG - Intergenic
1058824664 9:108764290-108764312 TACTATTCATTAAGTGAAAGTGG - Intergenic
1058843762 9:108935135-108935157 TTCCTTTCATTCAGTGATAATGG + Intronic
1059052133 9:110937817-110937839 TCATTTTGATGAAGTGAAAATGG + Intronic
1059453346 9:114384590-114384612 TTACTTTCATTAAGTGGAAGTGG - Intronic
1060452433 9:123755711-123755733 TACTGTTCATTAAGTGGAAGTGG - Intronic
1060705450 9:125794562-125794584 TTTTTTTAATAAATTGAAAATGG - Intronic
1060742096 9:126105663-126105685 TTTATTTCTTTAAGTGTAAATGG + Intergenic
1061091686 9:128430090-128430112 TTTTTTTCATTAGGTGGACATGG - Intronic
1061345077 9:130017298-130017320 TTCTTTTCATTAATTATACACGG + Intronic
1061644368 9:131988493-131988515 TACTATTCATTCAGTGGAAATGG - Intronic
1061645394 9:131996815-131996837 TACTGTTCATTAAGTGGAAGTGG - Intronic
1186019757 X:5240913-5240935 TACTATTCATTAAGTGGAAGTGG + Intergenic
1186125657 X:6411224-6411246 TGCTATTCATTAAGTGGAAGTGG + Intergenic
1186168740 X:6855177-6855199 TACTATTCATTAAGTGGAAGTGG - Intergenic
1186368764 X:8925308-8925330 TACTATTCATTAAGTGGAAGTGG + Intergenic
1186414537 X:9371823-9371845 TTTTTTTCATTAAGCAAATAAGG + Intergenic
1186900762 X:14053057-14053079 TACTATTCATTAAGTGGAAGTGG + Intergenic
1187081336 X:15991952-15991974 GTCTTTTCAATAAATGATAATGG - Intergenic
1187102393 X:16207487-16207509 TACTATTCATTAAGTGGAAGTGG + Intergenic
1187121658 X:16413567-16413589 TACTATTCATTAAGTGGAAGTGG - Intergenic
1187581689 X:20614155-20614177 TTCATTTAAATATGTGAAAAAGG + Intergenic
1187643947 X:21326442-21326464 TTCTCTTCCTTATGTGAGAAAGG + Intergenic
1187848641 X:23567559-23567581 TTGTGTTCATTAACAGAAAATGG + Intergenic
1188146123 X:26616151-26616173 TTCCTTTTATAAAGAGAAAAAGG - Intergenic
1188248146 X:27858516-27858538 TTCATTTCATTCAGTGACAATGG - Intergenic
1188315787 X:28671977-28671999 TTATTTTCAGTAAGAAAAAAGGG - Intronic
1188357710 X:29212786-29212808 TACTGTTCATTAACTGAAAGAGG + Intronic
1188395369 X:29675892-29675914 TTCTCATCAATAAATGAAAAAGG - Intronic
1188638906 X:32473544-32473566 TTCTTCTCATTTAGTGTAGAAGG - Intronic
1188673325 X:32907179-32907201 TTCATTTCATTGCGTGAAACAGG + Intronic
1188676853 X:32952060-32952082 GTCTTTCCCTTAAATGAAAAAGG + Intronic
1188713485 X:33431200-33431222 TTCTTCCCATTAAATTAAAATGG - Intergenic
1188842135 X:35029213-35029235 TACTATTCATTAAGTGGAAGTGG + Intergenic
1188971306 X:36618867-36618889 TTCTTTGTAGTAAGTGAAAATGG - Intergenic
1189031563 X:37457369-37457391 TTCTTTTTAATAAGGTAAAATGG + Intronic
1189184048 X:39036331-39036353 TTCTTTTTATACAGTCAAAATGG - Intergenic
1189715047 X:43856725-43856747 TACTATTCATTAAGTGGAAGTGG + Intronic
1189878288 X:45460626-45460648 TTCTTTGAAATAAGTAAAAATGG - Intergenic
1190362485 X:49662319-49662341 AACTTTTCATCAAGTGAAACAGG - Intergenic
1190594896 X:52042440-52042462 TTCTTTTCATTTGCTGAATAGGG + Intergenic
1190613928 X:52211633-52211655 TTCTTTTCATTTGCTGAATAGGG - Intergenic
1190772295 X:53525469-53525491 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1190855556 X:54290887-54290909 TTCTATATATTAGGTGAAAAGGG + Intronic
1191022120 X:55873076-55873098 TACTATTCATTAAATGGAAAAGG + Intergenic
1191025734 X:55911162-55911184 TACTATTCATTAAGTGAAAGTGG + Intergenic
1191100872 X:56726906-56726928 TTGTTTTCATTATATTAAAACGG - Intergenic
1191538313 X:62107157-62107179 TACTATTCATTAAGTGGAAGTGG + Intergenic
1191665710 X:63700523-63700545 TTCTTTTTTCTAACTGAAAATGG - Intronic
1191989488 X:67018767-67018789 TTTTCTTCATTATGTGAACAAGG - Intergenic
1192113821 X:68392213-68392235 TACTATTCATTAAGTGGAAGTGG - Intronic
1192735897 X:73849655-73849677 TTGTATGCATTAACTGAAAATGG + Intergenic
1193370121 X:80685981-80686003 TTCTTTTCAATAAAGGTAAAAGG - Intronic
1193669864 X:84371246-84371268 TTATTTTCATTATGTTAAAATGG + Intronic
1193738689 X:85191712-85191734 TACTATTCATTAAGTGGAAATGG + Intergenic
1193744631 X:85261026-85261048 TACTATTCATTAAGTGGAAGTGG + Intronic
1194505852 X:94732578-94732600 TTCTTCTCATAAAGTGGCAAAGG + Intergenic
1194573924 X:95587923-95587945 TACTATTCATTAAGTGGAAGTGG + Intergenic
1194619978 X:96159038-96159060 TTCTAATCATTAAGTGGAAGTGG - Intergenic
1194696579 X:97059714-97059736 TACTGTTCATTAAGTGGAAGTGG + Intronic
1195385264 X:104308196-104308218 TACTATTCATTAAGTGGAAGGGG - Intergenic
1195392413 X:104376432-104376454 TACTATTCATTAAGTGGAAGTGG - Intergenic
1195457554 X:105085918-105085940 TACTATTCATTAAGTGGAAGTGG + Intronic
1195513461 X:105744612-105744634 ATCCTTTCATTAAGTGAAAAGGG + Intronic
1196018902 X:110968781-110968803 TTCTTTTCATTCTGTTAACAGGG + Intronic
1196080930 X:111630121-111630143 TACTGTTCATTAAGTGGAAGTGG - Intergenic
1196172180 X:112601539-112601561 TTCTTCTAATTAAGTGAAACTGG + Intergenic
1196311950 X:114178730-114178752 TACTATTCATTAACTGAAAGTGG - Intergenic
1196346463 X:114665667-114665689 TGCTATTCATTAAGTGGAAGTGG + Intronic
1196546667 X:116971461-116971483 TTCATTTCATCGAATGAAAATGG + Intergenic
1197196342 X:123705279-123705301 CTTTTTTCATTTATTGAAAATGG - Intronic
1197691516 X:129505770-129505792 TTATTTTCATTAAGTTGAAGGGG - Intronic
1198070731 X:133145997-133146019 TACTATTCATTAAATGGAAATGG + Intergenic
1198437528 X:136631577-136631599 TACTATTCATTAAGTGGAATTGG - Intergenic
1199168577 X:144707704-144707726 TACTATTCATTAAGTCAAAGTGG - Intergenic
1199211574 X:145217750-145217772 TTTTTTTCAATAAGTAAACATGG + Intergenic
1199590768 X:149466421-149466443 TACTATTCATTAAGTGGAAGTGG - Intergenic
1199641338 X:149865332-149865354 TACTATTCATTAAGTGAAAGTGG + Intergenic
1199725576 X:150576775-150576797 GTATATTCTTTAAGTGAAAAGGG - Intronic
1200692385 Y:6319479-6319501 TTCTTTTCATAAAGTTTACATGG - Intergenic
1200763614 Y:7062246-7062268 TACTTGTTATTAAGGGAAAAAGG + Intronic
1201042887 Y:9855248-9855270 TTCTTTTCATAAAGTTTACATGG + Intergenic
1201524580 Y:14917659-14917681 TTCTTTTAATTGAATTAAAATGG + Intergenic
1201559145 Y:15297597-15297619 TACTATTCATTAAGTGGAAGTGG - Intergenic