ID: 1090371227

View in Genome Browser
Species Human (GRCh38)
Location 11:126254528-126254550
Sequence TTAAGTGAAAACGGAAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090371224_1090371227 10 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371227 11:126254528-126254550 TTAAGTGAAAACGGAAGGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090371227 Original CRISPR TTAAGTGAAAACGGAAGGTC AGG Intronic
905716613 1:40157127-40157149 GTAAGTAGAAACAGAAGGTCTGG + Intergenic
906261336 1:44393492-44393514 ATAATTGAAAAAGGAAGATCAGG - Intergenic
911283026 1:95954839-95954861 TGAAGTGAAAGAGGAAGATCAGG - Intergenic
913613227 1:120529174-120529196 TCAAGGGAGAAGGGAAGGTCGGG + Intergenic
914577960 1:148993073-148993095 TCAAGGGAGAAGGGAAGGTCGGG - Intronic
914881549 1:151550643-151550665 TTAAGTGAAAAAGCAAGCTGGGG - Intronic
918024455 1:180729382-180729404 TTAAGTGGCAACGGTAGTTCTGG + Intronic
918729876 1:187980046-187980068 TTAAGATAAAAAGGAAGGGCCGG + Intergenic
919096354 1:193041825-193041847 TTAAGTGAAAAAAGTAGGCCAGG + Intronic
923064038 1:230501655-230501677 TGAAGTGAAAAGTTAAGGTCTGG + Intergenic
1063152337 10:3348113-3348135 TTAAGTGAAAACATACGGACAGG + Intergenic
1065640297 10:27775225-27775247 TAAAGTGAAAAGGGAAGGGAAGG + Intergenic
1068112271 10:52693894-52693916 TTAAATGGAAATGGAAGCTCAGG - Intergenic
1068703204 10:60042565-60042587 TTCAGTGAAAAGGAAAGGACGGG + Intronic
1069826357 10:71257325-71257347 GTAAGTGAATAGGGAAGTTCAGG + Intronic
1070124621 10:73610765-73610787 TTAAATGAAAACAGAAGCTGAGG - Intronic
1072044045 10:91637146-91637168 TTTAGTGCAAACGGAATGGCTGG - Intergenic
1072985470 10:100135920-100135942 TTAAGTTAAAACTAAAGGTGAGG + Intergenic
1074094693 10:110300889-110300911 TTAAGTGAAAAAAGAAAGGCAGG + Intronic
1077939801 11:6828809-6828831 TTAAGTCAAAAAGAAAGGTAAGG - Intergenic
1079518786 11:21300347-21300369 TGAAATGAAAAAGGAAGGTAGGG + Intronic
1080369534 11:31619014-31619036 TTAAGTGAAAATGTAAGGAGAGG + Intronic
1081458586 11:43249857-43249879 TGAAGTCAAAAGGCAAGGTCTGG + Intergenic
1081481504 11:43493853-43493875 TTAAGTGACACTGGATGGTCTGG - Exonic
1083636543 11:64123808-64123830 TAAAGGGAAAACTGAAGGTCAGG + Intronic
1085956231 11:81399338-81399360 CCAAGTGAAAAAGGAAGGACAGG - Intergenic
1086402671 11:86473375-86473397 TAAAGTGAAAATGGAAGGGGAGG + Intronic
1086539862 11:87896221-87896243 ATGAGTGGAAATGGAAGGTCGGG - Intergenic
1090371227 11:126254528-126254550 TTAAGTGAAAACGGAAGGTCAGG + Intronic
1098930206 12:76403347-76403369 TGAAGTGTAAACTGAAAGTCTGG - Intronic
1101410886 12:104467299-104467321 TTAACTGAAAATGGAAGGTCTGG + Intronic
1102215416 12:111158147-111158169 TCAGGTGAAAACGGAGGATCAGG + Intronic
1106055149 13:26230449-26230471 TCAGGTGATAACTGAAGGTCTGG - Intergenic
1106639886 13:31573021-31573043 TGAACTTAAAACGGCAGGTCAGG - Intergenic
1107698139 13:43020902-43020924 TTCAGTGTAAAAGGAAGGTTTGG + Intergenic
1107727589 13:43315410-43315432 ATAAATGAAAACGGAAAATCAGG + Intronic
1110927350 13:81170766-81170788 TTAAGTGAAAAATGAAGGTATGG - Intergenic
1122362371 14:101175040-101175062 TGAAGTGGAAACGGATGGACTGG - Intergenic
1125060594 15:35417413-35417435 TTAATTGAGAATGGAAGGTCAGG + Intronic
1126918096 15:53488362-53488384 TTAAGTGAATACTGTAGGCCAGG + Intergenic
1127564411 15:60172833-60172855 TCCAGTGAAAACGGAAGGTCAGG - Intergenic
1129421954 15:75435395-75435417 TTAAGTGAAAACAGCAGGCTAGG + Intronic
1131370757 15:91879602-91879624 AGAAGAGAAAATGGAAGGTCAGG + Intronic
1137465428 16:48704330-48704352 TTAAGTGAAAAAACAAGGTGAGG - Intergenic
1138509976 16:57503107-57503129 TAAGGTGAAGACGGAAGGTGTGG + Intergenic
1140893721 16:79307083-79307105 TTGAGTGGAAAAAGAAGGTCAGG - Intergenic
1141095736 16:81161571-81161593 TTAAATGCAAAAGGGAGGTCAGG - Intergenic
1146079355 17:29763269-29763291 TGAAGAGTTAACGGAAGGTCTGG + Intronic
1148929610 17:51117836-51117858 TTATGTGAAAACTGATGGCCGGG + Intronic
1150922384 17:69496886-69496908 TTAAGTGAAAGAGGAAAGTCAGG - Intronic
1151201450 17:72470690-72470712 TTAAGTGAAAATGGAATCTGTGG - Intergenic
1156665789 18:39405132-39405154 TTTAGTGAAAAAGGAAGCACAGG + Intergenic
1156749292 18:40431002-40431024 ATAAGTTTAAACGGATGGTCTGG + Intergenic
1157886215 18:51369395-51369417 TTAAGAGAAAAGGGGTGGTCGGG - Intergenic
1160847713 19:1173788-1173810 TTACCAGAAAACGAAAGGTCGGG + Intronic
928902347 2:36333333-36333355 TTAAGTGAAAAGGTAAAGGCTGG - Intergenic
930258781 2:49121295-49121317 TGAAGAGAACACTGAAGGTCAGG - Intronic
935070916 2:99692680-99692702 TTCAGAGAAGAGGGAAGGTCGGG - Intronic
935531175 2:104234305-104234327 TTCAGTGGAAAAGGAAGGTCAGG - Intergenic
938915275 2:135932186-135932208 TTAAGTAAAAAAGGAAGATGTGG + Intronic
939171068 2:138696239-138696261 TTAAGTGAAAAATGATGTTCTGG + Intronic
940466889 2:154042188-154042210 TTAAGTGAAAATGGATATTCAGG - Intronic
941831395 2:169964555-169964577 TTAAGGGAAATGGGAAGCTCAGG + Intronic
941831673 2:169967981-169968003 TTAAGTGAAAAAGCAAGGTAGGG - Intronic
943425684 2:187730797-187730819 TTAATTGAAAACAAAAGGCCGGG + Intergenic
946360238 2:219215096-219215118 TCAAGTGAATAAGAAAGGTCTGG + Intronic
947544201 2:230999822-230999844 TTCAGTGAAAATGGAATTTCAGG - Intronic
1169081465 20:2799936-2799958 TTTGGTGAAAAGGGAAGGTTTGG + Intronic
1171275359 20:23852192-23852214 TTAAGTGAAAACTGAGGGGGTGG - Intergenic
1172311585 20:33922450-33922472 TTAAGTGGAAAGGGAAGGGGAGG - Intergenic
1174708788 20:52683969-52683991 TTAAGAAAAATCGGAAGTTCTGG - Intergenic
1178747209 21:35264593-35264615 TGAAGAGAAAACAGAAGCTCAGG - Intronic
1180845875 22:18981907-18981929 ATAAGTGAAAATGCAGGGTCAGG + Intergenic
1183266516 22:36829767-36829789 GGAAGTGGAAACGGAAGCTCAGG - Intergenic
1183651585 22:39157836-39157858 TTATGTGACATCAGAAGGTCTGG + Intergenic
1184571244 22:45326240-45326262 TCAAGAGAAAAAGGAAGGGCTGG - Intronic
952421202 3:33132715-33132737 TGAAGAGAAAAGGGAAGGTGTGG - Intronic
952565217 3:34649027-34649049 TCAAGAGAAAACTGAACGTCAGG + Intergenic
953111063 3:39938799-39938821 TAAAGTGAAAATAGAAGGGCCGG - Intronic
953749575 3:45598960-45598982 TGATGAGAAAACGGAAGCTCAGG + Intronic
953927918 3:46991740-46991762 CTAAGTGATGATGGAAGGTCTGG + Intronic
955091036 3:55750772-55750794 TTAAGTGCCAACGGAAAGACTGG + Intronic
957421162 3:79972565-79972587 GGAAGTGAAAATGGAATGTCAGG + Intergenic
957894878 3:86409357-86409379 TTAAATGAAAGCGGAAACTCAGG - Intergenic
958669406 3:97183796-97183818 TTTAATGAAAAAGGAAGGTCTGG - Intronic
960405790 3:117257785-117257807 TTAAGTGAAAAGAGAAGGAAGGG + Intergenic
962917842 3:139922438-139922460 TTAAGTGAAACCGGAAACACCGG - Intergenic
963751444 3:149184003-149184025 GTAAGTGAAAAGGGAATGCCTGG - Intronic
964490235 3:157228273-157228295 TAAAGAGAAAATGGAAGGTGAGG - Intergenic
966438673 3:179919119-179919141 TAAAGTGGAAAAGCAAGGTCAGG + Intronic
968055888 3:195691378-195691400 AGGACTGAAAACGGAAGGTCTGG - Intergenic
969849365 4:9944161-9944183 TGTAGTGGAAACAGAAGGTCAGG + Intronic
974984554 4:69005334-69005356 TAAAGTAGAAAAGGAAGGTCAGG + Intronic
975014781 4:69401583-69401605 TAAAGTAGAAATGGAAGGTCAGG - Intronic
975685096 4:76912916-76912938 ATAAGTGAAAATGTAAGATCTGG - Intergenic
980788314 4:137583342-137583364 TTAAGTTAAAAAGGAATGTGAGG - Intergenic
981415826 4:144492264-144492286 TTAAATGAAAAATTAAGGTCAGG - Intergenic
981923078 4:150108326-150108348 TTCAGTGAAAACTAAAGGTCAGG - Intronic
984027750 4:174564875-174564897 TTAAGTGAAAACAGACAGTTTGG - Intergenic
984660155 4:182364717-182364739 TTAGGTGAAAACTGAAGTTGGGG - Intronic
987912972 5:24172861-24172883 GTAAGTTAAAACTGAAGGTAAGG - Intronic
989744141 5:44808000-44808022 TTAAGTTAAAACAGATGGTACGG - Intergenic
990045944 5:51431459-51431481 TTAAGTTAAAACAGATGTTCAGG + Intergenic
992170274 5:74094751-74094773 CTAAGGGCATACGGAAGGTCTGG + Intergenic
995476825 5:112556388-112556410 GTAAGTGAAAAAGTAAGGTTTGG - Intergenic
998809874 5:145955561-145955583 TGAAGAGAAAAAGGAAGATCAGG + Intronic
1004722082 6:18276737-18276759 TTAAGTGAGAACAGAGGCTCCGG + Intergenic
1005266173 6:24114361-24114383 CTAAGTGAAAAAGAAAGCTCAGG - Intergenic
1010150895 6:72731171-72731193 TTAAGTGAAAATGAGAGGACAGG + Intronic
1011048371 6:83113010-83113032 TTAAATGAAAAAGGCAGGTTTGG + Intronic
1014544789 6:122721232-122721254 TTAAGTGATAATAGAATGTCTGG + Intronic
1015712537 6:136157854-136157876 ATAACTGAAAATGGAATGTCCGG + Intronic
1016301158 6:142633317-142633339 TTAAGTGAAAATGGAATTTGTGG + Intergenic
1020095832 7:5368690-5368712 TTAAGTGAAAAGGGCAGGGCAGG + Intronic
1028581611 7:92414837-92414859 TTAAGTGAAAAAGCAAAGGCAGG + Intergenic
1028647651 7:93116290-93116312 ATATGTGAAAACGTAAAGTCAGG + Intronic
1028876570 7:95830167-95830189 TTAAGTGACAAAGGAAGCTATGG - Intronic
1029164723 7:98579576-98579598 TTTAGTGATAAAGGAAGGTTAGG + Intergenic
1030761199 7:113354178-113354200 TGAAGTGAAAACACAAGCTCAGG + Intergenic
1033445224 7:141415476-141415498 TAAACTGAAAACTGAAGCTCAGG + Intronic
1034960037 7:155359339-155359361 TTCCGTGAAAAAGGAAGGGCAGG - Intronic
1036928414 8:12929947-12929969 ATAAATGAGAACTGAAGGTCAGG + Intergenic
1037410422 8:18589903-18589925 TTAAGTAAGAACGGAAGGCAAGG - Intronic
1038109869 8:24483996-24484018 CTAAGTGAATACAGAAGGGCAGG - Intronic
1038970932 8:32634237-32634259 TAAAATGAAAAGGGAAGATCAGG - Intronic
1039459387 8:37730724-37730746 TTAAGGGTAAATGGAAGGTGGGG + Intergenic
1039553918 8:38463301-38463323 TTCAGAGAAAAGGGAAGGGCTGG - Intronic
1041991380 8:63996150-63996172 TCAAAGGAAAAAGGAAGGTCAGG - Intergenic
1043598268 8:81909415-81909437 TGAAGAGAAAACGGAATGTCAGG - Intergenic
1044116167 8:88336955-88336977 TTAAATGAAAACGGAAAATGGGG - Intergenic
1044824663 8:96184580-96184602 TCAAGTGAAAATGCAAGGTCAGG + Intergenic
1047934363 8:129762303-129762325 TTAAATGAATAAGGATGGTCAGG + Intronic
1051907367 9:22111342-22111364 TTATTTTAAAAAGGAAGGTCTGG + Intergenic
1056462422 9:86820944-86820966 TTATGAGAAAACAGAAGGGCTGG - Intergenic
1056540351 9:87565682-87565704 TAAATTGAAAATGGTAGGTCTGG - Intronic
1056678269 9:88695273-88695295 TTAAGAGCAAAAGGAAGGACAGG - Intergenic
1059622213 9:116019283-116019305 TCAAGAGAAAATGGAAGGTAAGG - Intergenic
1185756338 X:2655891-2655913 TTAAATGTAAATGGAAGGGCAGG + Intergenic
1186986205 X:15016643-15016665 GAAAGTGAAAAGGGAAGGTAAGG + Intergenic
1188490285 X:30732084-30732106 ATAAGTGAAAAAGCAAGGTGCGG + Intergenic
1191817638 X:65265480-65265502 TTTAGTGAAAATTGAATGTCTGG + Intergenic
1192461636 X:71322059-71322081 TGAAGAGAAAGAGGAAGGTCTGG + Intergenic
1197997514 X:132394135-132394157 TTAAGTGGAAAGGGAACGCCAGG + Intronic