ID: 1090371228

View in Genome Browser
Species Human (GRCh38)
Location 11:126254529-126254551
Sequence TAAGTGAAAACGGAAGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090371224_1090371228 11 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371228 11:126254529-126254551 TAAGTGAAAACGGAAGGTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090371228 Original CRISPR TAAGTGAAAACGGAAGGTCA GGG Intronic
901773006 1:11540256-11540278 TCAGTGGCAAAGGAAGGTCAAGG - Intergenic
905788216 1:40774778-40774800 TAAGTGAAAAGGGAAGTAAAAGG - Intergenic
906558510 1:46735375-46735397 TGAGTGGAAATGGAAGGACAAGG + Intergenic
909252390 1:73375448-73375470 TAAGTGGTAACAGAAGGACACGG - Intergenic
910522350 1:88136978-88137000 TAAGTGGAAAAGAAAGGACAAGG + Intergenic
911283025 1:95954838-95954860 GAAGTGAAAGAGGAAGATCAGGG - Intergenic
916620046 1:166487256-166487278 TAAGTGACAAGTGAAGGTAAGGG - Intergenic
919656415 1:200201291-200201313 TCAGTGAAAACTGAAGGCTAGGG - Intergenic
920079914 1:203365457-203365479 GATGTGAAAACTGAAGATCAGGG - Intergenic
921393538 1:214643037-214643059 GAAGAGAAAATGGAAAGTCAAGG + Exonic
923371516 1:233318868-233318890 TAAGTGAAAAGGGATGGGAATGG - Intergenic
1068836850 10:61565142-61565164 TAAATAAAAACGTAAGTTCATGG - Intergenic
1070624467 10:78040800-78040822 TCAGTGAAAACTTAATGTCATGG + Intronic
1071030278 10:81171742-81171764 AAGGTGAAAAAGGAAGGTCCAGG + Intergenic
1071845917 10:89521062-89521084 TAAGAGAAAACTGAGGCTCATGG + Intronic
1072628396 10:97129079-97129101 TAAGTGAAAACTGAGGCACAGGG - Intronic
1075987001 10:126796911-126796933 TAAGAGAAAAAGGAAGGAAAAGG + Intergenic
1076407347 10:130221622-130221644 TAAGTGGAGACGGATGGGCAGGG - Intergenic
1083636544 11:64123809-64123831 AAAGGGAAAACTGAAGGTCAGGG + Intronic
1083771048 11:64867797-64867819 AAAGTGAAAACGAAAAGTCCTGG + Intronic
1085233078 11:74989436-74989458 TAAGTTGAAACTGAAGCTCAGGG - Intronic
1085956230 11:81399337-81399359 CAAGTGAAAAAGGAAGGACAGGG - Intergenic
1086539861 11:87896220-87896242 TGAGTGGAAATGGAAGGTCGGGG - Intergenic
1090371228 11:126254529-126254551 TAAGTGAAAACGGAAGGTCAGGG + Intronic
1092798659 12:12140685-12140707 CACGTGAAACCGGAAGGTGAAGG - Intronic
1093925608 12:24905412-24905434 CAAGTAAAATCTGAAGGTCAGGG - Intronic
1099491134 12:83289748-83289770 TGAGTGAAGAAGGAAGGACATGG + Intergenic
1099662546 12:85582969-85582991 CCAGTGAGAAAGGAAGGTCAGGG - Intergenic
1099841197 12:87969692-87969714 GAAGCGAAAAGGGAAGGTAATGG + Intergenic
1099925675 12:89013595-89013617 TAAGTGACAATTGAAGATCATGG + Intergenic
1100136795 12:91562898-91562920 TGAGTGAAATCAGAAGTTCAAGG - Intergenic
1100884045 12:99049940-99049962 TAAGTGAAAAGAGAAGTGCAAGG - Intronic
1101155257 12:101921870-101921892 TAAGTGAATACGGAAGACCTTGG + Exonic
1101880124 12:108620704-108620726 TGAGTGAAAAGGAGAGGTCAGGG + Intergenic
1102215417 12:111158148-111158170 CAGGTGAAAACGGAGGATCAGGG + Intronic
1103868844 12:124076258-124076280 GAAGTGAAATCAGAAGGCCAAGG - Intronic
1104710663 12:130983423-130983445 CAAGTGGAACAGGAAGGTCACGG - Intronic
1106477148 13:30108552-30108574 CAAGTGAGACGGGAAGGTCAAGG + Intergenic
1107593801 13:41939345-41939367 TATGTGAAAACGGAATCTTAAGG - Intronic
1108000179 13:45898465-45898487 TAAGTGAAAACTGAAGAACCTGG - Intergenic
1111504865 13:89174233-89174255 GAAGAGAAAAGGGAAGGGCAAGG - Intergenic
1112909208 13:104461104-104461126 ACAGGGAAAACGGAGGGTCAAGG - Intergenic
1113750459 13:112773315-112773337 TACATGAAAACAGAAGGGCAGGG - Intronic
1115453276 14:33573411-33573433 TTAGTGAATACTGAATGTCATGG + Intronic
1117378511 14:55137463-55137485 AGAGTGAAAAGGGAAAGTCATGG - Intronic
1120039094 14:79731871-79731893 TAAGTGAAATCGGATGGTCAAGG - Intronic
1120249813 14:82049750-82049772 GGAGTGAAAAAGGAAGGACAAGG + Intergenic
1125060595 15:35417414-35417436 TAATTGAGAATGGAAGGTCAGGG + Intronic
1125331703 15:38589036-38589058 TAAGTGCAAACGGCAGGAAAGGG - Intergenic
1126652028 15:50932815-50932837 GCAGTGAAAACGTAAGGTGATGG + Intronic
1127378470 15:58406919-58406941 TTAGGCAAAACGGAAGGACAAGG + Intronic
1130112528 15:80977500-80977522 TAAGTGGAAACAGAAGGTACAGG + Exonic
1131370758 15:91879603-91879625 GAAGAGAAAATGGAAGGTCAGGG + Intronic
1131569286 15:93517483-93517505 TAAATGAAAAGGGCAGGTTAAGG + Intergenic
1133812618 16:9172579-9172601 TAAGTTTAAACAGTAGGTCATGG - Intergenic
1134976872 16:18577586-18577608 TTAATGAAAAGGGAAAGTCAAGG + Intergenic
1135023359 16:18980837-18980859 TAAGTGAAAAAGCAAGGTGGAGG - Intergenic
1136400069 16:30012033-30012055 TGAGTGAAGACCGAAGGCCAGGG - Intronic
1141410818 16:83831720-83831742 GAAGTGGAAAGCGAAGGTCAAGG - Intergenic
1141612406 16:85189488-85189510 TCAGTGAAAATGGGAGGTTAGGG + Intergenic
1141652775 16:85402420-85402442 TGAGCGAATAGGGAAGGTCATGG + Intergenic
1142927849 17:3256819-3256841 TAAAACAAAAGGGAAGGTCAAGG - Intergenic
1143417326 17:6759332-6759354 GATGTGAAAAAGGAAGGTCCTGG + Intronic
1143646016 17:8230643-8230665 TCTGTGAAACTGGAAGGTCAGGG + Exonic
1147189569 17:38730675-38730697 TCAGTGGAAAGGGAAGGACACGG - Intronic
1153006830 18:504539-504561 GATATGAAGACGGAAGGTCATGG + Intergenic
1154966696 18:21365023-21365045 TAATTAAAAATGGAAGGTCTAGG - Intronic
1156290542 18:35745877-35745899 TAAGTAAAAAGGGAGAGTCATGG - Intergenic
1156749293 18:40431003-40431025 TAAGTTTAAACGGATGGTCTGGG + Intergenic
1157593039 18:48847416-48847438 TAAGTGGAAATGGAAGGTGCTGG - Intronic
1159003114 18:62990489-62990511 GAAGTGAAAAAGGAAGCACAAGG - Intergenic
1163610495 19:18298783-18298805 TAAGGGAAAACAGAGGGCCAGGG + Intergenic
1166048710 19:40245235-40245257 TAAGAGAAAAAGGAAGGTGCAGG + Intronic
928239444 2:29573846-29573868 TAAGGGAAAATGGAATGTGATGG + Intronic
930258780 2:49121294-49121316 GAAGAGAACACTGAAGGTCAGGG - Intronic
934477439 2:94602799-94602821 CCAGTGAAAATGGTAGGTCAGGG - Intronic
935357745 2:102219936-102219958 GAAGTGAAAATGGAAGATTATGG + Exonic
935531174 2:104234304-104234326 TCAGTGGAAAAGGAAGGTCAGGG - Intergenic
937976761 2:127587120-127587142 AAAGTGAAAGAGGAAAGTCAGGG + Intronic
939007803 2:136809396-136809418 TAAGTGAAGATGGTAGGACATGG + Intronic
939689233 2:145237220-145237242 TGAGTGCAAAGGGAAAGTCAAGG - Intergenic
940466888 2:154042187-154042209 TAAGTGAAAATGGATATTCAGGG - Intronic
1171386941 20:24776851-24776873 GAAGTGAGACTGGAAGGTCAAGG + Intergenic
1171470268 20:25364733-25364755 TAGGTGAAAATGGAACCTCATGG - Intronic
1171474511 20:25397817-25397839 AAAGTGAAAAGGGAAGGGAAAGG + Intergenic
1172311584 20:33922449-33922471 TAAGTGGAAAGGGAAGGGGAGGG - Intergenic
1173287527 20:41686732-41686754 AAAGAGAAAAAGGAAGGTCCAGG - Intergenic
1173376268 20:42486283-42486305 TAAGTCAAAAATGAAAGTCAAGG - Intronic
1174909543 20:54592485-54592507 TGAGGGAAAACTGAAGGACAAGG - Intronic
1177366447 21:20144720-20144742 TAAAAGACAATGGAAGGTCATGG - Intergenic
1177872190 21:26587513-26587535 TAAGTGCAAATGAAAGGGCATGG - Intergenic
1179464515 21:41562757-41562779 TGGGTGAAAACGGGAGGGCATGG - Intergenic
1180602876 22:17033973-17033995 CAATTGAGCACGGAAGGTCAAGG + Intergenic
1183266515 22:36829766-36829788 GAAGTGGAAACGGAAGCTCAGGG - Intergenic
949819782 3:8103639-8103661 TATGTGAAAAGGGAATGTCTTGG + Intergenic
950975304 3:17236104-17236126 TAAGTGAGAAAGGAAGTGCATGG - Intronic
951113930 3:18837636-18837658 TAAGTGAAAAAGGCCTGTCAAGG + Intergenic
953749576 3:45598961-45598983 GATGAGAAAACGGAAGCTCAGGG + Intronic
955116293 3:56007640-56007662 TAAATGTAAACGGAAGGTTCAGG - Intronic
955459393 3:59163941-59163963 TAAGAGAAATCAGAAGGCCATGG - Intergenic
962111664 3:132456968-132456990 GAAATGAAAAAGGAAGGTGAGGG + Intronic
963358553 3:144240714-144240736 TAATTAAAAATAGAAGGTCAAGG + Intergenic
963751443 3:149184002-149184024 TAAGTGAAAAGGGAATGCCTGGG - Intronic
966438674 3:179919120-179919142 AAAGTGGAAAAGCAAGGTCAGGG + Intronic
966489203 3:180507762-180507784 TAAGAGGAAAAGGAAGGACATGG - Intergenic
966774082 3:183528734-183528756 GATGAGAAAACTGAAGGTCATGG - Intronic
967552011 3:190807144-190807166 TAAATGTAAAAGGATGGTCATGG - Intergenic
967605739 3:191443824-191443846 TCAGTGAACAAGGCAGGTCAAGG - Intergenic
968055887 3:195691377-195691399 GGACTGAAAACGGAAGGTCTGGG - Intergenic
969849366 4:9944162-9944184 GTAGTGGAAACAGAAGGTCAGGG + Intronic
970606491 4:17686594-17686616 GAAGAGAAAACTGAAGGTGAGGG - Intronic
975014780 4:69401582-69401604 AAAGTAGAAATGGAAGGTCAGGG - Intronic
976016811 4:80565354-80565376 TAAGTAAAAAAGCAAGGTCAAGG + Intronic
977048098 4:92091748-92091770 AGAGTGAAATGGGAAGGTCAAGG - Intergenic
978385032 4:108169540-108169562 TAAGAGAGAACAGAAGGACAAGG + Intergenic
980246847 4:130256849-130256871 GAAGTAAAAAAGGAAAGTCAGGG + Intergenic
980822771 4:138038520-138038542 TGAGTGAAAACAAAGGGTCAAGG + Intergenic
994118159 5:96084231-96084253 CAAGAGAAAAAGGAAGGTTAGGG + Intergenic
994161943 5:96566570-96566592 TAAGTGAATACAGTGGGTCATGG - Intronic
995688248 5:114795049-114795071 TTAGAGAAAACGGAAGCTCCAGG + Intergenic
997151504 5:131500951-131500973 TATGTGTAAACAGAAAGTCAAGG + Intronic
997897305 5:137730824-137730846 TAAGTGAAAATGAAAAGTCCAGG + Intronic
998809875 5:145955562-145955584 GAAGAGAAAAAGGAAGATCAGGG + Intronic
1004501564 6:16214668-16214690 GATGTGAAAATAGAAGGTCAAGG + Intergenic
1007084801 6:39135832-39135854 TAAGTGGAATTGGAAGGACAGGG + Intergenic
1007955439 6:45914035-45914057 TAAATGAAAACTGAAGCTCAAGG + Intronic
1009817736 6:68757510-68757532 AAAATAAAAACGGAAGGTAAAGG - Intronic
1010814472 6:80340993-80341015 TAAGTGTAAAGTGAAGTTCATGG + Intronic
1013670888 6:112401230-112401252 AAAGTGAAAAAGGGAGGCCAAGG - Intergenic
1014065473 6:117119735-117119757 TAAGTGAAACTGGAAATTCAAGG + Intergenic
1016943737 6:149507964-149507986 TAAGTGAAAACTGAAAAGCAAGG + Intronic
1018742139 6:166738064-166738086 TAAATGCAAAAGGCAGGTCATGG - Intronic
1021528412 7:21615700-21615722 TAAGTGAAAAAGTAAGTTCTAGG + Intronic
1022585754 7:31607683-31607705 TAATTTAAAACTGAAGGGCATGG - Intronic
1023256616 7:38318782-38318804 TAAATGAAGATGGAAGGACAGGG - Intergenic
1026065402 7:67067405-67067427 TAAGTAAAAATGAAAGGTCATGG + Intronic
1026711475 7:72744460-72744482 TAAGTAAAAATGAAAGGTCATGG - Intronic
1028951131 7:96636327-96636349 AACTTGAAAAGGGAAGGTCATGG + Intronic
1032036581 7:128525854-128525876 GAACTGAAACCGGAGGGTCATGG - Intergenic
1032520161 7:132537833-132537855 AAATTGACAACAGAAGGTCATGG - Intronic
1033190278 7:139271807-139271829 CAAGTAAAAATGCAAGGTCAAGG - Intronic
1033229129 7:139583033-139583055 TAACTGAAAAGGGAAGGAAAGGG - Intronic
1034960036 7:155359338-155359360 TCCGTGAAAAAGGAAGGGCAGGG - Intronic
1036151662 8:6304865-6304887 TAAGAGGAAACCGTAGGTCAGGG + Intergenic
1037361601 8:18080526-18080548 TAAGTGGAACAGGAAGCTCAGGG - Intronic
1038699742 8:29838789-29838811 TATGTGAAAACTGAATGTAAAGG + Intergenic
1038752093 8:30305191-30305213 TAAGTGGAGGCAGAAGGTCAGGG - Intergenic
1040324244 8:46333654-46333676 CAAGTGAAAACGGGAAGGCAGGG + Intergenic
1041024799 8:53672939-53672961 TCAGTGGATACTGAAGGTCAGGG + Intergenic
1041250004 8:55924698-55924720 AAAGAGGAAATGGAAGGTCATGG - Intronic
1041991379 8:63996149-63996171 CAAAGGAAAAAGGAAGGTCAGGG - Intergenic
1043093701 8:75937567-75937589 TAAGTGAAATGGGAATGTAATGG + Intergenic
1043093705 8:75937599-75937621 TAAGTGAAATAGGAATGTAATGG + Intergenic
1050027700 9:1352785-1352807 GAAGTGAAAAAGGAATGTGATGG - Intergenic
1051880175 9:21832004-21832026 TAAGTGACAAAGGAATTTCACGG - Intronic
1052869554 9:33490430-33490452 TAAGTGAAATAAGCAGGTCACGG - Intergenic
1054952771 9:70871544-70871566 TAAGTGAAAAAGGAAGTCCCAGG + Intronic
1055120999 9:72660827-72660849 AAAATGAAAAGGGAAGGACAAGG - Intronic
1057178930 9:93019226-93019248 TAAGTGAAAAAGCAAGGTGCAGG - Intronic
1057688846 9:97264651-97264673 TAAGTGAAATAAGCAGGTCACGG + Intergenic
1059647314 9:116280216-116280238 GCAGTGAAAAAGGAAGGCCAGGG + Intronic
1060557199 9:124514062-124514084 TAAGTGGAAACTGAGGCTCAGGG - Intergenic
1060773818 9:126353655-126353677 TAAGGGAAAAAGAAAAGTCAAGG - Intronic
1062357227 9:136170677-136170699 GAAGAGGAAACGGAGGGTCAGGG - Intergenic
1186655895 X:11611714-11611736 TAAGTGGAAATGCAAGGGCAAGG - Intronic
1186986206 X:15016644-15016666 AAAGTGAAAAGGGAAGGTAAGGG + Intergenic
1188318935 X:28711264-28711286 AAGGTGAAAAAGGAATGTCAAGG + Intronic
1189993324 X:46614900-46614922 TAAATGAAAACAGAAAGTGAGGG - Intronic
1192371128 X:70513814-70513836 AAATTGAAAACGGAAGGGAAAGG + Intergenic
1193682025 X:84533370-84533392 TAGGTGGAAATGAAAGGTCAAGG - Intergenic
1194867172 X:99084015-99084037 TAAGGAAAAAAGGAAGGACATGG - Intergenic
1195608063 X:106831854-106831876 TAAGTGAAAACAGAATATTATGG - Intronic
1195731988 X:107977651-107977673 TAAGTGAAGATGGAAAGGCAGGG - Intergenic
1197275726 X:124476638-124476660 TAAGTAGATACGGAAGGTGAAGG - Intronic
1197967108 X:132076872-132076894 CAAGTGAAAATGTATGGTCAGGG - Intergenic
1198058544 X:133020311-133020333 TAAGTGAAACCACAAGGCCAAGG - Intergenic