ID: 1090371229

View in Genome Browser
Species Human (GRCh38)
Location 11:126254530-126254552
Sequence AAGTGAAAACGGAAGGTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090371224_1090371229 12 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371229 11:126254530-126254552 AAGTGAAAACGGAAGGTCAGGGG 0: 1
1: 0
2: 3
3: 16
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090371229 Original CRISPR AAGTGAAAACGGAAGGTCAG GGG Intronic
902785437 1:18730068-18730090 AGGTGAAAAAGGAAGGGGAGGGG + Intronic
904680189 1:32223599-32223621 ATGAGAAAACTGAAGTTCAGAGG + Intronic
906366305 1:45212987-45213009 AGGTGATAACGGAGGGTGAGGGG - Intronic
906635084 1:47404143-47404165 ATGAGAAAACTGAAGTTCAGAGG - Intergenic
907344826 1:53766951-53766973 AAGTGAAACCAAAACGTCAGAGG - Exonic
907712637 1:56898515-56898537 AGGTGAATAAGGAAGGGCAGAGG - Intronic
908130988 1:61075432-61075454 AAGTGGAAATGGATGCTCAGTGG + Intronic
908937535 1:69394152-69394174 AAGTGAGAAGAGAAGTTCAGAGG - Intergenic
909348076 1:74615929-74615951 AAGCTAACAGGGAAGGTCAGAGG + Intronic
912323311 1:108734926-108734948 ATGAGAAAACTGAAGCTCAGAGG + Intronic
912406080 1:109438679-109438701 AGGTGATAACGGACGGTGAGGGG + Intergenic
918020285 1:180681056-180681078 AAGGGAAGAGGGCAGGTCAGAGG + Intronic
918827953 1:189351422-189351444 AAGTGAAAATGAAAGTTCACAGG - Intergenic
918907452 1:190515201-190515223 AAGAGAAGAGGGAAGGTGAGGGG - Intergenic
920701958 1:208224693-208224715 GAGTGAAGAAGGAAGGTGAGAGG + Intronic
921308216 1:213818082-213818104 ACGGGAAAACAGAAAGTCAGTGG - Intergenic
921393539 1:214643038-214643060 AAGAGAAAATGGAAAGTCAAGGG + Exonic
922860457 1:228811738-228811760 AAGTGAAATCTGAAGGTCCTTGG + Intergenic
1063338979 10:5245050-5245072 CAGTGACAGCGGAAGGTAAGGGG - Intergenic
1063344119 10:5295317-5295339 CAGTGACAGCGGAAGGTAAGGGG + Intergenic
1071030279 10:81171743-81171765 AGGTGAAAAAGGAAGGTCCAGGG + Intergenic
1071086449 10:81873663-81873685 AAGTGAAAACCGAAGAGGAGGGG - Intergenic
1072069278 10:91900811-91900833 AAGGGGAAACAGAAGGTCGGAGG + Intergenic
1072645530 10:97251278-97251300 AAGGGAAAAAGGAAGGGAAGGGG + Intronic
1072697118 10:97611964-97611986 AAGTCAGAAAGGAAGGGCAGAGG + Exonic
1073815497 10:107201950-107201972 AAGTGAATATGGAAAGTAAGAGG + Intergenic
1074058330 10:109942642-109942664 AAGTGAAGATAGAAGGTCTGGGG + Intronic
1075399953 10:122153768-122153790 ATGAGAAAACGGAAGCACAGAGG + Intronic
1075710335 10:124527301-124527323 AAGTGAAGAAGGAAGGAAAGGGG + Intronic
1075771664 10:124943167-124943189 AAGTGAAAATGGATTTTCAGAGG + Exonic
1075870021 10:125765204-125765226 AAGGGGAAACGGAATGACAGTGG - Intergenic
1076407346 10:130221621-130221643 AAGTGGAGACGGATGGGCAGGGG - Intergenic
1076437911 10:130459283-130459305 AGGTGAAAAGGGAAGGGTAGAGG + Intergenic
1082777654 11:57259826-57259848 AAGTCAAAATGGAAGGGGAGAGG + Intergenic
1082932373 11:58622053-58622075 AAATGAAATTGGAAAGTCAGTGG + Intronic
1083771049 11:64867798-64867820 AAGTGAAAACGAAAAGTCCTGGG + Intronic
1084161740 11:67353829-67353851 AAGGGAAAACGGGAAGTGAGAGG - Intronic
1085053610 11:73392036-73392058 AAGGGAAAACAGGAGGGCAGTGG + Intronic
1085789399 11:79484151-79484173 AAGTGAAAGAGGAGAGTCAGTGG - Intergenic
1086470405 11:87103149-87103171 AAGTGAAATCGGTATGTCAAAGG - Intronic
1086539860 11:87896219-87896241 GAGTGGAAATGGAAGGTCGGGGG - Intergenic
1086876252 11:92099122-92099144 AATGGAAAACAGAAGGTCAATGG + Intergenic
1089673523 11:120073488-120073510 AAGTGAAACCTGAACGTCACAGG + Intergenic
1090144701 11:124309135-124309157 TAGTGAAAACACATGGTCAGAGG + Intergenic
1090371229 11:126254530-126254552 AAGTGAAAACGGAAGGTCAGGGG + Intronic
1090501053 11:127261857-127261879 AAGAGAAATTGTAAGGTCAGAGG + Intergenic
1090529949 11:127580117-127580139 ATGAGAAAACTGAAGCTCAGAGG - Intergenic
1090650493 11:128801938-128801960 AAGTGAAAATGGAAGAGCAGAGG + Intronic
1090869426 11:130729926-130729948 ATGAGAAAAAGGAAGATCAGAGG + Intergenic
1092367972 12:7892769-7892791 AAGAGAAAAGGGAAGGAGAGAGG + Intergenic
1094395400 12:29999897-29999919 AAGTGAAAAGGGCAGGCAAGAGG + Intergenic
1094399926 12:30051551-30051573 AATAGAAAATGGAAAGTCAGGGG + Intergenic
1094609611 12:31980612-31980634 AAGTAAAAACAGAAGGTGATTGG + Intronic
1096384137 12:51183550-51183572 GAGTGAAAAGGGAAGGCTAGGGG - Intergenic
1096395549 12:51263417-51263439 AAGGAAAAACTGAAGTTCAGGGG - Intronic
1097333923 12:58361232-58361254 AACAGAAAATGGAAAGTCAGAGG + Intergenic
1097712272 12:62930013-62930035 AAGGGAAAAAGAAAGGCCAGGGG + Intronic
1099841198 12:87969693-87969715 AAGCGAAAAGGGAAGGTAATGGG + Intergenic
1100246049 12:92757930-92757952 TGGTGAAACCGGAAGTTCAGTGG + Intronic
1101842848 12:108340462-108340484 AAAAGAAAAGGGAAGGGCAGGGG + Intergenic
1102902166 12:116647188-116647210 AAGGGAAAAAGGAAGGGAAGGGG - Intergenic
1103868843 12:124076257-124076279 AAGTGAAATCAGAAGGCCAAGGG - Intronic
1105438995 13:20400284-20400306 GAGAGAAAACAGAAGGGCAGAGG - Intergenic
1105768803 13:23587743-23587765 AAGAGAAAACTGAAGGTCCAAGG - Intronic
1105956711 13:25289965-25289987 AAGGGAAATCGGAATGCCAGCGG - Intergenic
1106477149 13:30108553-30108575 AAGTGAGACGGGAAGGTCAAGGG + Intergenic
1108378785 13:49837416-49837438 AAATGAAAAAGGATGGGCAGGGG + Intergenic
1109147605 13:58799969-58799991 ACGTAAAAATGGAAGGGCAGAGG - Intergenic
1109270488 13:60250613-60250635 AAGTGAGAAGGGAAGTTCAGAGG - Intergenic
1110162060 13:72390237-72390259 AAGGTAAAACAGAAGGTCTGAGG + Intergenic
1110775229 13:79401069-79401091 AACTGAAAAGGAAAGGTCAAAGG + Intronic
1111504864 13:89174232-89174254 AAGAGAAAAGGGAAGGGCAAGGG - Intergenic
1111673606 13:91359373-91359395 AAGTGAAAGAGGGAGGTAAGAGG - Intergenic
1113232455 13:108228848-108228870 ATGAGAAAACAGAAGCTCAGGGG - Intronic
1116778691 14:49211936-49211958 ATGTGAATACGGCTGGTCAGAGG - Intergenic
1117335670 14:54755317-54755339 AAGTGGAAATGGCAAGTCAGTGG + Intronic
1117544005 14:56776062-56776084 AAGTGTATACAGATGGTCAGAGG - Intergenic
1118721767 14:68599530-68599552 AAATGAAAACAGAAAGTCAGAGG + Intronic
1118736030 14:68702590-68702612 AAGTGCAGAAGGAAGGCCAGGGG + Intronic
1119108892 14:71952389-71952411 AAGAGAAAAAGGAAGTACAGAGG - Intronic
1119332533 14:73805653-73805675 ATGAGAAAACTGAAGGACAGAGG + Intergenic
1120923761 14:89778461-89778483 AACTGAGTACAGAAGGTCAGTGG - Intergenic
1121363475 14:93284856-93284878 AAGTGAGAGCAGAGGGTCAGAGG + Intronic
1122567172 14:102667642-102667664 AGTTGGAAACTGAAGGTCAGTGG + Intronic
1124869229 15:33523736-33523758 AAGTGAAGAGGGACAGTCAGAGG + Intronic
1125988531 15:44080890-44080912 ATTTGCAAATGGAAGGTCAGAGG + Intronic
1126852859 15:52808221-52808243 AAGAGAAAACTGAAGTTCTGAGG - Intergenic
1129821383 15:78604329-78604351 AAGAGAAAACTGACGGTCAAAGG + Intronic
1130643384 15:85700949-85700971 AACTAAAAACGTGAGGTCAGAGG - Intronic
1131090056 15:89617293-89617315 AAGTGAAATTGGTGGGTCAGAGG + Intronic
1132006454 15:98232216-98232238 AAGAGGAAACTGAAGGTCTGAGG - Intergenic
1132007036 15:98236616-98236638 AAGCTAAAAAGGAAGGTGAGAGG - Intergenic
1132152783 15:99474394-99474416 AAGTGAAAGGGGAAGGGAAGGGG + Intergenic
1132399469 15:101496586-101496608 AAGTGAAGGCAGGAGGTCAGAGG - Intronic
1134412245 16:14012678-14012700 ATGAGAAAATGGAAGCTCAGGGG + Intergenic
1135005251 16:18815439-18815461 AACTGAAAACACAAAGTCAGAGG - Exonic
1135537138 16:23302896-23302918 AGGTGCAAACTGAGGGTCAGAGG + Intronic
1136400068 16:30012032-30012054 GAGTGAAGACCGAAGGCCAGGGG - Intronic
1138509978 16:57503109-57503131 AGGTGAAGACGGAAGGTGTGGGG + Intergenic
1139845267 16:69916568-69916590 AATGGAAAATGGAAAGTCAGTGG + Intronic
1140253516 16:73315815-73315837 AACTGAAAACGGGAAGTGAGTGG - Intergenic
1140798423 16:78462586-78462608 AAGTGGAACCGGGAGATCAGAGG + Intronic
1141410817 16:83831719-83831741 AAGTGGAAAGCGAAGGTCAAGGG - Intergenic
1141528440 16:84628749-84628771 AAGAGAAAACTGGAGCTCAGGGG - Intergenic
1142038649 16:87878398-87878420 AAGGGAACACGGAGGGACAGCGG + Intergenic
1143388648 17:6547139-6547161 ATGAGAAAACTGAAGCTCAGAGG + Intronic
1143485512 17:7251668-7251690 AAGGGAAAAGGGAAGGGGAGGGG + Intronic
1148211993 17:45814097-45814119 AAGGGAAGAAGGAAGGGCAGGGG + Intronic
1150506648 17:65705575-65705597 AAAAGAAAAAGGAAGGACAGAGG + Intronic
1154016263 18:10620586-10620608 AGGTAAAAACAGAAGGCCAGAGG - Intergenic
1158359748 18:56658559-56658581 ATGTGAAAACAGAAGGTAACTGG - Intronic
1160324142 18:77926414-77926436 AAGTGAAAAGGTAATGACAGAGG + Intergenic
1161414358 19:4137094-4137116 AAGTGGAAACTGAGGCTCAGAGG - Intergenic
1164677336 19:30110251-30110273 AATTAAAAAAGGAAGGTTAGAGG + Intergenic
1166347351 19:42175036-42175058 AAGTGAAAACGGGAGGAAATTGG - Intronic
1168109199 19:54182051-54182073 AAGGGAAAAGGGAAGGACGGAGG + Intronic
926059897 2:9798706-9798728 AAGAGAAAACTGAAGCCCAGAGG + Intergenic
926158954 2:10474760-10474782 AAGAAAAAACGGAGGGTCTGGGG - Intergenic
926608823 2:14924672-14924694 AAATGAAAACTGAAGCTCACAGG - Intergenic
926611489 2:14952499-14952521 AACAGAAAACAGAAGATCAGAGG + Intergenic
928756150 2:34528073-34528095 AAGAGAAAATGGAAGGGGAGTGG - Intergenic
928956871 2:36878269-36878291 TAGTGAAAAGGAAAGGACAGTGG - Intronic
929772806 2:44906870-44906892 AAGTGAAAATGCAAGTTAAGTGG + Intergenic
931432409 2:62218725-62218747 AGGAGAAAATGGAAGCTCAGAGG - Intronic
931435617 2:62243653-62243675 AAGTGAAGAGGGCAGGTCAGAGG - Intergenic
933626198 2:84603423-84603445 AAGGGAAGACCCAAGGTCAGAGG - Intronic
933919206 2:87027631-87027653 AAGAGAGAAGGGAATGTCAGTGG + Intergenic
934003788 2:87742276-87742298 AAGAGAGAAGGGAATGTCAGTGG - Intergenic
934477438 2:94602798-94602820 CAGTGAAAATGGTAGGTCAGGGG - Intronic
935195963 2:100816695-100816717 AAGTGAAAACTGATAATCAGAGG + Intergenic
935308485 2:101759820-101759842 AAGGGAAAAGGGAAGGGAAGGGG - Intronic
935354747 2:102187733-102187755 CAGGAAAAAGGGAAGGTCAGCGG + Intronic
935541493 2:104354066-104354088 ATGGGAAAACTGAAGCTCAGGGG + Intergenic
935597348 2:104889537-104889559 ATGGGAAAACCAAAGGTCAGAGG + Intergenic
937182753 2:120011359-120011381 CAGTGAAAACAGAAGCTCTGAGG - Intergenic
938951312 2:136257140-136257162 AAGTGAAAACGCAGGATCAGAGG - Intergenic
939287343 2:140149721-140149743 AAGTTCAGAGGGAAGGTCAGCGG + Intergenic
940466887 2:154042186-154042208 AAGTGAAAATGGATATTCAGGGG - Intronic
940608790 2:155964006-155964028 ATAAGAAAACGGAAGGTAAGAGG - Intergenic
941469274 2:165864236-165864258 AAGAGAAAAGGGAAGATGAGTGG + Intronic
942456446 2:176141367-176141389 AAGAGATAACGGAGGATCAGTGG - Intergenic
944237001 2:197450054-197450076 AAGTAAAAAAGGAAGGGAAGGGG - Intergenic
944273952 2:197814450-197814472 CACTGACAACGGCAGGTCAGTGG - Intronic
945071048 2:205989324-205989346 AAGTAAAAATGGAAGGAAAGGGG - Intergenic
946360240 2:219215098-219215120 AAGTGAATAAGAAAGGTCTGGGG + Intronic
948193616 2:236078866-236078888 AAGTGAGAAAGGAAAGGCAGTGG - Intronic
1169058126 20:2640791-2640813 AAGTGATGACGGAAGGGGAGGGG - Intronic
1169107485 20:3009341-3009363 CAGACAAAAGGGAAGGTCAGTGG + Intronic
1169878989 20:10326953-10326975 AAGGGAAAAAAGCAGGTCAGTGG + Intergenic
1171088613 20:22262887-22262909 ATGTGAAAGCTGAAGCTCAGAGG - Intergenic
1171474512 20:25397818-25397840 AAGTGAAAAGGGAAGGGAAAGGG + Intergenic
1172311583 20:33922448-33922470 AAGTGGAAAGGGAAGGGGAGGGG - Intergenic
1173072296 20:39780178-39780200 AAGTGAAAACAGTATGGCAGTGG + Intergenic
1173668510 20:44780644-44780666 AAGGGAAAGCTGAAGCTCAGGGG + Intronic
1174602015 20:51732391-51732413 AAGGGAAGAAGGAAGGTCTGTGG - Intronic
1175312237 20:58019914-58019936 AAGTGGAAACTGAGGCTCAGAGG - Intergenic
1178931032 21:36819448-36819470 ATGTGAAAACGAAAGGTCAGAGG - Intronic
1181266770 22:21635192-21635214 CAGAGAAAACGCAAGGACAGAGG + Exonic
1182468134 22:30530859-30530881 ATGGCAAAAAGGAAGGTCAGGGG + Intronic
1182635607 22:31724374-31724396 AAGTGAATACGCTAAGTCAGTGG - Intronic
1182756972 22:32688209-32688231 ATGAGGAAACTGAAGGTCAGGGG + Intronic
1183427012 22:37745686-37745708 ATGAGAAAACGGAGGCTCAGAGG - Intronic
949616795 3:5762477-5762499 ATGAGAAAACTGAAGATCAGAGG + Intergenic
949905300 3:8853792-8853814 ATGTGAAAACTGACGTTCAGTGG + Intronic
950476656 3:13219276-13219298 AAGAGGAAGCCGAAGGTCAGCGG + Intergenic
951112455 3:18820374-18820396 AATTGAAAACAGAGGGTTAGCGG - Intergenic
952160224 3:30685874-30685896 AATTGAAGATGGAAGGTCTGTGG + Intronic
952949809 3:38513655-38513677 AAATTAAAACAGAAAGTCAGAGG - Intronic
952967708 3:38631422-38631444 AAGTGGAAACAGAAAGTGAGAGG + Intronic
953600230 3:44355896-44355918 AAATGAGAACGGAAGCTCAGAGG + Intronic
953698236 3:45176503-45176525 ATGAGAAAACTGAAGCTCAGAGG - Intergenic
953842189 3:46397688-46397710 AACTGAAAACTGAAAGACAGGGG + Intergenic
955170311 3:56557440-56557462 AAGTGAAAACGTAAGGTCTGTGG - Intronic
955712895 3:61798828-61798850 AAGTAGAAAAGGAAGGTCAGTGG + Intronic
955719790 3:61868516-61868538 AAGTGAACAAGGAAAGGCAGAGG - Intronic
956957683 3:74359391-74359413 AAGAGGAAACGGAGGTTCAGAGG + Intronic
957215096 3:77309956-77309978 AACTGAAAATGGAAAGTAAGTGG + Intronic
960258870 3:115542051-115542073 ATGGGAGAACGGCAGGTCAGTGG + Intergenic
960972466 3:123149717-123149739 AAAAGAAAACGGAGGCTCAGAGG + Intronic
963678180 3:148340535-148340557 ATGCGAAAACTGAAGGGCAGAGG + Intergenic
965442155 3:168727965-168727987 ATGTGAAAACTGAAGCTCAGAGG + Intergenic
967126628 3:186429968-186429990 AAGTGGAAACTGAAGTCCAGAGG - Intergenic
967136141 3:186514510-186514532 ATGAGAAAACTGAAGTTCAGAGG + Intergenic
968055886 3:195691376-195691398 GACTGAAAACGGAAGGTCTGGGG - Intergenic
969163636 4:5283904-5283926 AAGTGAAAACAAAAACTCAGTGG + Intronic
969234339 4:5854866-5854888 AAGTGGAATTAGAAGGTCAGAGG - Intronic
969849367 4:9944163-9944185 TAGTGGAAACAGAAGGTCAGGGG + Intronic
970746704 4:19306886-19306908 AAGTGAAAACTACATGTCAGAGG + Intergenic
970752647 4:19383364-19383386 AAGTGAAGAAGTAAGCTCAGTGG - Intergenic
970810815 4:20092108-20092130 AAGTGAAAACCAAAGTGCAGAGG - Intergenic
971407104 4:26331853-26331875 AAGGGAAGATGGAAGGACAGAGG + Intronic
972234476 4:37114987-37115009 AAGTGAGAAAGGAAAGTTAGTGG - Intergenic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972813482 4:42616811-42616833 AAGAAGAAACAGAAGGTCAGAGG + Intronic
972998709 4:44917923-44917945 ATGTGAAAATGGAAGGTTATAGG + Intergenic
975014779 4:69401581-69401603 AAGTAGAAATGGAAGGTCAGGGG - Intronic
975354791 4:73389184-73389206 AAGTGTAAACATAAGGTCAATGG + Intergenic
976354080 4:84095238-84095260 CAGTGACAACGGTAGATCAGTGG + Intergenic
976479201 4:85519981-85520003 AAGTAAACACGAAAGGTGAGAGG - Intronic
977854010 4:101865598-101865620 AAGTGAGACAGGAAGGCCAGAGG - Intronic
978508942 4:109494514-109494536 AAGTAAAAAGGAAATGTCAGGGG + Intronic
979098712 4:116587276-116587298 AAGTGAAATAGAAAGGTCACAGG - Intergenic
980246848 4:130256850-130256872 AAGTAAAAAAGGAAAGTCAGGGG + Intergenic
980336381 4:131479191-131479213 AAGTGAAGGCAGGAGGTCAGCGG - Intergenic
982317229 4:154044100-154044122 AAATGGAAAAGGAAGCTCAGAGG + Intergenic
982567998 4:157010476-157010498 ATGTGAAAACTGAATGTCACTGG - Intergenic
984901503 4:184590629-184590651 TCGGGAAAACGGAAGGGCAGGGG + Intergenic
984911383 4:184676804-184676826 AAGGGAAAAGGGAAGGGAAGGGG - Intronic
986201288 5:5581222-5581244 AAGTGGAAACAAAAGGTGAGAGG - Intergenic
987670572 5:21002045-21002067 TAGTGAAAAAAAAAGGTCAGAGG - Intergenic
990999674 5:61770070-61770092 ATGGGAAAACGGAGGCTCAGGGG + Intergenic
991249459 5:64543827-64543849 AAAAGAAAAGGGAAGGGCAGAGG + Intronic
994552112 5:101248367-101248389 AAGTGAAACCTGAAGGCCAAAGG + Intergenic
995901677 5:117076278-117076300 AAGTGAGAAAGGAAGCACAGAGG - Intergenic
996020172 5:118582437-118582459 AGGTGAAAGCAGAAGGTCACTGG + Intergenic
996408526 5:123130195-123130217 AAGGGAAAAGGGAAGGGGAGAGG - Intronic
998617818 5:143760278-143760300 ATGAGAAAACTGAGGGTCAGAGG + Intergenic
998877795 5:146618193-146618215 AAGTGAAATAGGAAGGCAAGAGG + Intronic
999846433 5:155486027-155486049 AAGTGATATAGGAAGGTAAGTGG + Intergenic
999917417 5:156278159-156278181 AAGAGAAACTGAAAGGTCAGTGG + Intronic
1000419561 5:161022935-161022957 AAGTAGAAAGGGAAGGTGAGAGG + Intergenic
1000849829 5:166326125-166326147 AAGAAAAAAAGGAGGGTCAGGGG + Intergenic
1003033763 6:2624753-2624775 AAGTGAAAAATGAGGTTCAGAGG + Intronic
1003354337 6:5352516-5352538 AAGGGAGAACGGAAGGCCTGAGG + Intronic
1003965918 6:11251974-11251996 AAGTGCAAGCAGAAGGTGAGGGG - Intronic
1004126693 6:12881191-12881213 ATGTAAAAAAGGAAGGACAGTGG + Intronic
1007079899 6:39092568-39092590 GAGGGAAAAAGGAAGGACAGAGG - Intergenic
1007933535 6:45713522-45713544 ATGAGAAAACGGAGGTTCAGTGG + Intergenic
1008126632 6:47676477-47676499 AAGAGGAAACTGAAGCTCAGAGG + Intronic
1008796156 6:55305453-55305475 AAGTGAGAGAGGAAGCTCAGGGG - Intergenic
1010577713 6:77553268-77553290 AAGTGAGAAAGGAATATCAGTGG - Intergenic
1010770638 6:79825547-79825569 ACGTTAAAAAGGAAGGTGAGAGG - Intergenic
1010905287 6:81479500-81479522 AAGTCAAAAGGGAAGCCCAGGGG - Intergenic
1011015066 6:82745340-82745362 ATGAGAAAACTGAAGGTCAAAGG - Intergenic
1011287436 6:85740015-85740037 AGGTGAAAATGGAAGGTCAGTGG - Intergenic
1012970441 6:105724258-105724280 AAGTGACAAGGGCAGGTCAGTGG + Intergenic
1014960774 6:127681938-127681960 AAGTGACAATAGAAAGTCAGTGG + Intergenic
1015920998 6:138266349-138266371 AAGGGAAAACGGAAGGGAAAAGG + Intronic
1018127571 6:160696440-160696462 AAGAGAGAAGGGAACGTCAGTGG - Intergenic
1018929460 6:168231014-168231036 ATGAGAAAACGGAAGGTCCCAGG - Intergenic
1018994472 6:168700801-168700823 AAGGGAAAATGGAAAGTCACTGG + Intergenic
1019405736 7:882996-883018 AAGAGACAAAAGAAGGTCAGAGG - Intronic
1019886924 7:3913267-3913289 AAGTGTAAGAGAAAGGTCAGAGG - Intronic
1020268448 7:6577559-6577581 AAGGGGAAAGGGAGGGTCAGAGG - Exonic
1021060003 7:16099497-16099519 AAGGGAAAAGGGAAGGAAAGAGG + Intronic
1022015167 7:26343386-26343408 ACAAGAAAGCGGAAGGTCAGAGG - Intronic
1024225790 7:47325872-47325894 AAGTGGAAACAGAAGGGTAGAGG + Intronic
1025233019 7:57215474-57215496 AAGTGAACACGCATGGTGAGGGG + Intergenic
1026062880 7:67041836-67041858 ATGAGAAAACGGAAGCACAGAGG - Intronic
1028090621 7:86696315-86696337 GAGAGAAACAGGAAGGTCAGAGG + Intronic
1028282092 7:88943522-88943544 AAGTGAAGACTCCAGGTCAGAGG - Intronic
1031496373 7:122453820-122453842 AAGTGAGAAAGGTAAGTCAGGGG + Intronic
1031697749 7:124879589-124879611 AAGTTAAAATGGAAGAGCAGGGG + Intronic
1033122522 7:138678623-138678645 AAGTTAATACGGGGGGTCAGTGG + Intronic
1033498926 7:141928019-141928041 AAGTGAAAACTCAAATTCAGTGG + Exonic
1034112086 7:148547080-148547102 AAATGAAAAGGGAAGGGCAGCGG - Intergenic
1034702089 7:153105451-153105473 AAGGGAAAAGGGAAGGGGAGGGG - Intergenic
1036151663 8:6304866-6304888 AAGAGGAAACCGTAGGTCAGGGG + Intergenic
1036600390 8:10255421-10255443 AATTGAAAACGGAATTTCACTGG - Intronic
1037945954 8:22989649-22989671 AAGAGGAAACTGAAGGCCAGAGG + Intronic
1038112336 8:24513440-24513462 AAGGGAAGACGGTGGGTCAGGGG + Intronic
1038463880 8:27742188-27742210 AACTGAAAACTGAAGACCAGTGG + Intronic
1039699907 8:39951543-39951565 ATGTGAAAATTGAGGGTCAGGGG - Intronic
1040454685 8:47584886-47584908 AAGAGAGAAAGGAAGGGCAGGGG - Intronic
1040977047 8:53205008-53205030 ACATGAAAACAGAAGGTCTGTGG - Intergenic
1041024800 8:53672940-53672962 CAGTGGATACTGAAGGTCAGGGG + Intergenic
1041634627 8:60129376-60129398 AAGTGAGAAGACAAGGTCAGAGG - Intergenic
1041902957 8:63002072-63002094 CAGTAAAAAGGGAAGGTCAGTGG - Intergenic
1043875889 8:85485486-85485508 CAGGGAAAAGGGCAGGTCAGTGG - Intergenic
1044917605 8:97132201-97132223 AAGTGAAAACCACTGGTCAGAGG + Intronic
1044946788 8:97396982-97397004 CAGTGATAAAGGCAGGTCAGAGG + Intergenic
1045017657 8:98012862-98012884 ATGAGAAAACTGATGGTCAGAGG - Intronic
1048505470 8:135016930-135016952 AAGTGAAGACTCAAGGTGAGGGG - Intergenic
1050601438 9:7256545-7256567 AATTGAAAACAGAAAATCAGTGG - Intergenic
1051165714 9:14260206-14260228 CAGTGAAAACTGAAGCTCACTGG + Intronic
1052765697 9:32638396-32638418 AAGTGAAAACCAGAGGTCAATGG - Intergenic
1052852533 9:33386765-33386787 CAGTGAAAATGGTAGGTCGGGGG + Intronic
1053308345 9:36999824-36999846 AAGTGAGACCTGAAGGCCAGAGG - Intronic
1053680632 9:40483316-40483338 CAGTGAAAATGGTAGGTCGGGGG + Intergenic
1053930620 9:43111628-43111650 CAGTGAAAATGGTAGGTCGGGGG + Intergenic
1054283080 9:63141619-63141641 CAGTGAAAATGGTAGGTCGGGGG - Intergenic
1054293714 9:63318831-63318853 CAGTGAAAATGGTAGGTCGGGGG + Intergenic
1054391738 9:64623320-64623342 CAGTGAAAATGGTAGGTCGGGGG + Intergenic
1054503989 9:65893008-65893030 CAGTGAAAATGGTAGGTCGGGGG - Intronic
1055120998 9:72660826-72660848 AAATGAAAAGGGAAGGACAAGGG - Intronic
1055274092 9:74594797-74594819 AAGAGAAAAAGGAAGGAAAGAGG + Intronic
1056785814 9:89591848-89591870 AAGAGAAAACGGAACATTAGAGG - Intergenic
1057369341 9:94455868-94455890 AAGAAAAAATGAAAGGTCAGTGG + Intronic
1057485662 9:95481271-95481293 AACTGTACACTGAAGGTCAGGGG + Intronic
1057763355 9:97893942-97893964 AATTGAAAACGGAACAACAGAGG - Intergenic
1057880746 9:98791098-98791120 AAGAGAAAAAGCAAGGGCAGCGG - Intronic
1058420373 9:104827745-104827767 AACTGCAAGGGGAAGGTCAGTGG - Intronic
1059164797 9:112067548-112067570 AAGTGAACACGGTAGGGAAGTGG + Intronic
1059705437 9:116819006-116819028 GTGAGAAAATGGAAGGTCAGGGG + Intronic
1061309943 9:129755604-129755626 AGGAGGAAACGGAAGCTCAGAGG - Intergenic
1062170583 9:135132690-135132712 GAGTGGAAAGGGCAGGTCAGCGG + Intergenic
1186102682 X:6173516-6173538 CAGTCAAAAAGGCAGGTCAGAGG - Intronic
1186107102 X:6219414-6219436 AAGAGAAAAAGGAAGGAGAGAGG - Intronic
1186521340 X:10209323-10209345 AAGGGAAAAGGGAAGGGAAGGGG - Intronic
1186614921 X:11176161-11176183 AAGTGAAAACTTAGGGCCAGGGG - Intronic
1188276571 X:28208051-28208073 AAGTGAGAAGGGAAGTTTAGAGG + Intergenic
1188334562 X:28914941-28914963 CAGTGAAAACTGTAGATCAGTGG + Intronic
1188468567 X:30511094-30511116 AAGTGTAAATGGAATGTAAGGGG + Intergenic
1189722235 X:43932306-43932328 AAGGGAAAACTGAGGTTCAGAGG - Intergenic
1189993323 X:46614899-46614921 AAATGAAAACAGAAAGTGAGGGG - Intronic
1190617880 X:52256072-52256094 AAGTGAAAATAGAAAATCAGTGG - Intergenic
1193826727 X:86235420-86235442 AGGTGAAGATGGAAGGTAAGCGG - Intronic
1194318326 X:92410428-92410450 AAGTGAAATCGGTACTTCAGTGG + Intronic
1194455201 X:94094906-94094928 AAGTGATAGCTGAAGGTGAGGGG - Intergenic
1195973943 X:110505098-110505120 AAGGGAAAAGGGAAGGGAAGGGG - Intergenic
1196236858 X:113291815-113291837 AAGTGAAAAAGGAGAGGCAGAGG + Intergenic
1198114125 X:133528499-133528521 AAGGGAAAGGGGAAAGTCAGGGG - Intergenic
1198676630 X:139138207-139138229 ATGGTAAAACGGAAGGTTAGAGG + Intronic
1199173744 X:144760126-144760148 ATTTGAAAACGGACAGTCAGAGG + Intergenic
1199966876 X:152827723-152827745 AAGTGATAAAGGGAGGTCCGTGG + Exonic
1200626494 Y:5523720-5523742 AAGTGAAATCGGTACTTCAGTGG + Intronic
1201665030 Y:16441795-16441817 AAGTGAAAATGGAAATACAGGGG + Intergenic
1202055467 Y:20825713-20825735 AAGTGAGAAGGGAAGTTTAGAGG - Intergenic
1202136500 Y:21670925-21670947 AAGGGAAAAGGGAAGGGAAGGGG - Intergenic