ID: 1090371230

View in Genome Browser
Species Human (GRCh38)
Location 11:126254535-126254557
Sequence AAAACGGAAGGTCAGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090371224_1090371230 17 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371230 11:126254535-126254557 AAAACGGAAGGTCAGGGGCTAGG 0: 1
1: 0
2: 2
3: 18
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090371230 Original CRISPR AAAACGGAAGGTCAGGGGCT AGG Intronic