ID: 1090371230

View in Genome Browser
Species Human (GRCh38)
Location 11:126254535-126254557
Sequence AAAACGGAAGGTCAGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090371224_1090371230 17 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371230 11:126254535-126254557 AAAACGGAAGGTCAGGGGCTAGG 0: 1
1: 0
2: 2
3: 18
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090371230 Original CRISPR AAAACGGAAGGTCAGGGGCT AGG Intronic
900771904 1:4552092-4552114 AAACCAGAAGGTAAGTGGCTTGG - Intergenic
900917460 1:5648821-5648843 AAAATGTAAGGTCCGGAGCTTGG - Intergenic
901919740 1:12527712-12527734 AGAAAGGCAGGTCATGGGCTTGG - Intergenic
903055780 1:20635003-20635025 AAAAGACAAGGTCAGGGGCTGGG - Intronic
903165783 1:21519499-21519521 AAAACTGAAGCTCAGAGGCTGGG + Intronic
903562648 1:24239744-24239766 AAAAAGGAAGGTCTGGGCTTTGG - Intergenic
906101564 1:43267246-43267268 AAAACACAAGGGCAGGGGATAGG + Intronic
906545286 1:46615937-46615959 AAAATGTAAGCTCAGGGGGTGGG + Intronic
909146462 1:71939668-71939690 AAAAAGGCAAGTCAGGGGCAGGG + Intronic
909898305 1:81101709-81101731 AAAACATAAGGTCAGAGACTTGG - Intergenic
910266789 1:85346391-85346413 AAAATGGAAAGTCAGGAGATAGG + Intronic
910665780 1:89724858-89724880 AAAATGGAAGCTCAGGGGCTTGG - Intronic
910781371 1:90938646-90938668 AAAGTGGAAGGTCAGGAGCCTGG - Exonic
911694593 1:100875433-100875455 AAAGGGGAAGGTCAGGGGATGGG + Intronic
915962492 1:160278837-160278859 ATAGAGGAAGGTCAGGGGCTGGG + Exonic
916421327 1:164640383-164640405 AACAAGGTAGGTCAGGGGTTTGG + Intronic
917119701 1:171634778-171634800 AAAACTGAAGTGGAGGGGCTGGG + Intergenic
919840319 1:201604379-201604401 AAAACTGAAGCTCATGGGCCGGG + Intergenic
919915602 1:202137149-202137171 AAAATGGCAGGGCATGGGCTGGG - Intronic
924521548 1:244810397-244810419 GAAAAGGAAGGTCAGGGCCCTGG + Intergenic
1063456449 10:6185933-6185955 AAAACTGGAGGACAGGGGCCAGG - Intronic
1063918602 10:10909377-10909399 ACAGCGGAAGTCCAGGGGCTAGG + Intergenic
1064215686 10:13398407-13398429 AAAACTAAAGTTCATGGGCTGGG - Intergenic
1064676464 10:17765113-17765135 AAAAGGGAAAATCTGGGGCTGGG - Intronic
1066558502 10:36641835-36641857 AGAAAGAAAGGTCATGGGCTTGG - Intergenic
1067984843 10:51131449-51131471 AAAACGGAAGATGATGGGCTGGG + Intronic
1068296770 10:55080856-55080878 AAAACTGACTGTCTGGGGCTGGG - Intronic
1069613932 10:69794293-69794315 AGAATGGAAGGTCAGGTGTTTGG + Intergenic
1070631417 10:78087685-78087707 AAAATGGGAGTTCAGGGGCCAGG - Intergenic
1071031268 10:81184590-81184612 TAAATGGAAGGTCAGTGGTTTGG + Intergenic
1072340626 10:94445025-94445047 AAAAGGGAATGTGAGGGGCCGGG - Intronic
1073322928 10:102626533-102626555 AGCACAGCAGGTCAGGGGCTTGG + Intronic
1074405794 10:113179282-113179304 AAAAAGGAAGAACAGAGGCTTGG - Intergenic
1074509682 10:114101000-114101022 GAAACAGAAGGTCAGGGCCGTGG + Intergenic
1075078924 10:119369897-119369919 TAAACGGAGGGTCAGGGGTGGGG - Intronic
1077103036 11:830541-830563 TACACGGAGGGCCAGGGGCTGGG - Intronic
1077177979 11:1199204-1199226 AAAGAGGAAGGGCAGGGTCTGGG + Intronic
1077619046 11:3702707-3702729 TCAACGGAACCTCAGGGGCTGGG + Exonic
1078424806 11:11240498-11240520 AAAAAGGAAAGACAGGGGCAAGG - Intergenic
1080123029 11:28699083-28699105 AAAAATGAAGATCAGAGGCTGGG - Intergenic
1080573661 11:33579077-33579099 AAAGTGGAAGAGCAGGGGCTGGG - Intronic
1084045190 11:66564129-66564151 AAAAGGGAACGTCAGAGCCTGGG + Exonic
1084116395 11:67045223-67045245 AGAACTGAAGACCAGGGGCTGGG + Intronic
1084329266 11:68420929-68420951 AAAATGAAAGCTCAGGGGCCGGG + Intronic
1088736527 11:112732266-112732288 AGAACGGATGGGCAAGGGCTGGG + Intergenic
1090371230 11:126254535-126254557 AAAACGGAAGGTCAGGGGCTAGG + Intronic
1091017217 11:132062930-132062952 GAAAGGAAAGCTCAGGGGCTTGG + Intronic
1091587981 12:1827029-1827051 ACCAAGGAAGGTCAGAGGCTGGG + Intronic
1092230191 12:6772008-6772030 AAAATGGTAGGTCTGAGGCTAGG - Intergenic
1092232677 12:6785295-6785317 AAAAGGGAAGGGTAGGGACTGGG - Intergenic
1092973649 12:13723286-13723308 AAAACAAAAGGTGGGGGGCTAGG - Intronic
1100400134 12:94222253-94222275 AAAACGGCAGGTGAAGGGTTGGG - Intronic
1100403789 12:94255002-94255024 GCAACGGAAGGGCAGGGCCTGGG + Intronic
1100756444 12:97756344-97756366 AAATCGAAAGGTCAGGTGCTAGG - Intergenic
1100909345 12:99339770-99339792 AAAAGCCAAGGTCAGGGGCAAGG - Intronic
1100922264 12:99501525-99501547 AACAAGGCAGGTCAGGGGGTGGG - Intronic
1101842851 12:108340467-108340489 AAAAGGGAAGGGCAGGGGAGGGG + Intergenic
1104707521 12:130958493-130958515 AAAAAGGAAGGACTGGGGCTGGG - Intronic
1105546688 13:21355860-21355882 AAAAAGGACGTTCTGGGGCTGGG + Intergenic
1106719731 13:32426124-32426146 AGAATGGAACATCAGGGGCTTGG - Intronic
1107028213 13:35824933-35824955 AAAACTGAAGGGGAGGGGATGGG - Intronic
1107114520 13:36732734-36732756 AAAACTGAAGGCCTGGGCCTGGG - Intergenic
1108378788 13:49837421-49837443 AAAAAGGATGGGCAGGGGGTGGG + Intergenic
1112056957 13:95698360-95698382 TAAACAGAAGCTCAGGGGATGGG - Intronic
1113281221 13:108789991-108790013 TAAGCTGAAGGTGAGGGGCTGGG + Intronic
1113491672 13:110697167-110697189 AAGAAGGAAGGTCAGTGGTTCGG - Intronic
1113693892 13:112330648-112330670 GAAACCGAAGGTCACGGGCGAGG + Intergenic
1115036072 14:28858243-28858265 AAAACGGAAGTGTAGGAGCTCGG + Intergenic
1115641162 14:35336596-35336618 CAAGTGGAAGGTCAAGGGCTGGG + Intergenic
1116645803 14:47527411-47527433 AAAAAGGAAGGGCAGGAGGTAGG + Intronic
1117108282 14:52421172-52421194 AAAATGGAAGATAAGGGGATGGG - Intergenic
1117534234 14:56688685-56688707 GAAATGGAAACTCAGGGGCTAGG - Intronic
1118591798 14:67407414-67407436 AAAAAATAAGGTTAGGGGCTGGG - Intronic
1120776192 14:88440259-88440281 AATAGGGCAGGTCTGGGGCTTGG - Intronic
1122510406 14:102262134-102262156 AAAAATAAAGGCCAGGGGCTGGG - Intronic
1123999074 15:25739888-25739910 GAAACGCAAGTTCAGGGGCAGGG - Intronic
1127107784 15:55635383-55635405 AAAACGGCAAGACAGAGGCTGGG - Intronic
1127564409 15:60172826-60172848 AAAACGGAAGGTCAGGAGATTGG - Intergenic
1128008284 15:64266369-64266391 AAGAGACAAGGTCAGGGGCTGGG - Intronic
1129164418 15:73768206-73768228 AAGAGGGAAGGTTGGGGGCTGGG + Intergenic
1129238285 15:74236736-74236758 AAAAGGTAAGGCCAGGGGCATGG + Exonic
1129985872 15:79919437-79919459 AGCACGGAAGGTGCGGGGCTCGG + Intronic
1133036279 16:3036024-3036046 GACCCGGGAGGTCAGGGGCTGGG - Intronic
1133036819 16:3038215-3038237 AGATGGGAAGGTCCGGGGCTGGG + Intergenic
1133786278 16:8975884-8975906 AAAAAGAAATGTCCGGGGCTGGG - Intergenic
1135706972 16:24683490-24683512 AAAACTGCAGGATAGGGGCTGGG - Intergenic
1136255395 16:29035601-29035623 ATGACGGAAGGCCAGGGGGTAGG - Intergenic
1136287449 16:29252848-29252870 CAAAGGGAAGGTGAGGGGCAGGG + Intergenic
1136508597 16:30722297-30722319 AAAAAGGCAGGACAGGGGGTGGG - Intronic
1136631134 16:31489897-31489919 TAAACACAAGCTCAGGGGCTTGG + Exonic
1136683965 16:31983479-31983501 AAAAGGGAAGGCTCGGGGCTGGG - Intergenic
1136784591 16:32927031-32927053 AAAAGGGAAGGCTCGGGGCTGGG - Intergenic
1136885192 16:33926775-33926797 AAAAGGGAAGGCTCGGGGCTGGG + Intergenic
1138424051 16:56918615-56918637 AAAGCGGCAGGTCAGGGGCCAGG + Intergenic
1139845269 16:69916573-69916595 AAAATGGAAAGTCAGTGGCAGGG + Intronic
1140259640 16:73366434-73366456 AAAAGAGAAAGACAGGGGCTGGG + Intergenic
1140277819 16:73526541-73526563 AAAACTGGAGGCCAGGGCCTGGG - Intergenic
1140365074 16:74374905-74374927 ATGACGGAAGGCCAGGGGGTAGG - Intergenic
1142093064 16:88225477-88225499 CAAAGGGAAGGTGAGGGGCAGGG + Intergenic
1203087250 16_KI270728v1_random:1191037-1191059 AAAAGGGAAGGCTCGGGGCTGGG - Intergenic
1142701830 17:1667179-1667201 AAAAAGGAGGGCCAGGGGCCAGG + Intronic
1143148465 17:4791360-4791382 GAAACAGAAGGGCTGGGGCTGGG - Intergenic
1143501914 17:7344114-7344136 GAAACAGAAGGTGAGGGGCCAGG + Exonic
1145850102 17:28084855-28084877 AAAAGGTAGGGACAGGGGCTGGG - Intronic
1146664550 17:34688956-34688978 AAAAAGGATGGGCAGGGGCAGGG + Intergenic
1146960794 17:36975683-36975705 AGAACAGTAGGTCAGGAGCTAGG + Intronic
1149782787 17:59411252-59411274 AAACAGGATTGTCAGGGGCTGGG - Intergenic
1150804418 17:68308006-68308028 TAAAAGGAAAGTAAGGGGCTAGG + Intronic
1152179038 17:78806424-78806446 AAAAGGGGAGGTGAGGGGCAGGG + Intronic
1152553620 17:81042085-81042107 AAAATGGAAGAGCAGGGGCTTGG - Intronic
1157960955 18:52152721-52152743 AAATAGGAAGGTAAGGGGATGGG + Intergenic
1160628772 18:80231041-80231063 CAAATGGAAGGTCAGGGACAAGG + Intronic
1161273642 19:3404014-3404036 AAAGGGGCAGGCCAGGGGCTGGG - Intronic
1162597138 19:11638366-11638388 GAAAATGAAGGTCTGGGGCTGGG + Intergenic
1163581379 19:18141235-18141257 AAAACTGAGGCTCAGGGGCCAGG - Intronic
1165591371 19:36972812-36972834 CAAACGGAGGGTCAGGGAGTGGG - Intronic
1167126014 19:47549201-47549223 AAAACGTCTGTTCAGGGGCTGGG - Intronic
1167140115 19:47644489-47644511 AAAAAGGAAGGTGAAGGGGTAGG - Intronic
1167357433 19:49012471-49012493 GAAACTGCAGGTCAGGGCCTGGG + Intronic
1167408802 19:49332864-49332886 GAAACAGAAGCTGAGGGGCTGGG + Intergenic
1167675761 19:50884242-50884264 ATAAAGGAAGGACCGGGGCTTGG - Intergenic
925311928 2:2890894-2890916 AGCAAGGAAGCTCAGGGGCTGGG + Intergenic
925863232 2:8200532-8200554 AGAACATAAGGACAGGGGCTGGG + Intergenic
927087657 2:19687544-19687566 CAAAAGGAAGGGCAGGAGCTGGG + Intergenic
928595118 2:32852740-32852762 AAAATTGACGGTCTGGGGCTGGG - Intergenic
931460765 2:62448384-62448406 GAAACAGAAGGGCAGAGGCTGGG + Intergenic
931545546 2:63381269-63381291 AAAAACTAAGGTCAGGGGGTGGG - Intronic
932721962 2:74145112-74145134 AGGACAGAGGGTCAGGGGCTTGG - Intronic
933805151 2:85993708-85993730 AAAAAAGAAGCTGAGGGGCTGGG + Intergenic
935354748 2:102187738-102187760 AAAAGGGAAGGTCAGCGGCCTGG + Intronic
935881725 2:107572351-107572373 TAAACACAGGGTCAGGGGCTGGG - Intergenic
936442223 2:112564525-112564547 AAAACCTAAGGTCAAGGGATAGG - Intronic
937527997 2:122794877-122794899 AAAACTGAGGGTCAGAGACTTGG + Intergenic
938277949 2:130044126-130044148 AAATTGGAGGGTCAGGGGATGGG - Intergenic
941499236 2:166248962-166248984 AAAAGTTAAGGTCAGAGGCTGGG - Intronic
941665439 2:168240086-168240108 AAAATGGAAGGGAAGGGTCTTGG + Intronic
942444191 2:176067351-176067373 AAGACGGAAAGTCCGGGGCCAGG + Intergenic
942701519 2:178716599-178716621 AATAGTGGAGGTCAGGGGCTGGG - Intronic
946073386 2:217053548-217053570 AAAAAGGAAGAACATGGGCTTGG - Intergenic
946902157 2:224383160-224383182 AAATCAGGAGGTCATGGGCTGGG - Intronic
948077775 2:235179813-235179835 ACAACGTAAGGACAGGTGCTGGG - Intergenic
1169081468 20:2799943-2799965 AAAAGGGAAGGTTTGGGGCTTGG + Intronic
1170099058 20:12678713-12678735 AAAAGAGAAGGTAATGGGCTGGG - Intergenic
1170129750 20:13006555-13006577 GAAAGGGAAGGACAGAGGCTTGG - Intergenic
1170587023 20:17742535-17742557 AAAAGGGGAGCTCAGGGGCCGGG + Intergenic
1172699265 20:36842978-36843000 AAAACGGAAAGGAAGGGACTGGG + Intronic
1173028353 20:39330771-39330793 AAAAAGGTAGCTGAGGGGCTTGG - Intergenic
1174323301 20:49759379-49759401 AAAATGGAAGGGAAGGGGCAGGG - Intergenic
1174460953 20:50682310-50682332 AAAATGTAAGTGCAGGGGCTGGG + Intronic
1174546962 20:51332839-51332861 AAAAAGGAGGGGCAGGGGCCAGG - Intergenic
1175136796 20:56830197-56830219 AAACCGGAAGGTGTGGGGGTGGG - Intergenic
1181692411 22:24571405-24571427 GAGACGGAGGGGCAGGGGCTGGG - Intronic
1183848389 22:40562550-40562572 AAAACGGAAGGGAAGGGGAAGGG + Intronic
1184492864 22:44820308-44820330 AGAGAGGAAGGTGAGGGGCTGGG + Intronic
950228879 3:11258964-11258986 AAAAAGTAAGGTCAGAGACTTGG - Intronic
950527832 3:13534937-13534959 AAAAGTGAAGAGCAGGGGCTGGG - Intergenic
951646618 3:24899084-24899106 CCAATGGAAGGTCAGGGGCAGGG - Intergenic
952001451 3:28790006-28790028 AAAAAGGAAAGACAGGGGATGGG - Intergenic
952159674 3:30681195-30681217 AAAAAGAAAGGGAAGGGGCTGGG + Intronic
953275207 3:41489040-41489062 TAAACTGAGGGTCAGGGGTTGGG - Intronic
953415683 3:42714994-42715016 AAAATTAAAGTTCAGGGGCTGGG + Intronic
953541048 3:43818499-43818521 AAAAGGGAAGGAGAGGGGCAGGG - Intergenic
953727648 3:45414572-45414594 AAAAAGCAAAGTAAGGGGCTGGG + Intronic
956482178 3:69684182-69684204 AAAACTGAAGGTCTTGGGCCAGG + Intergenic
957554738 3:81751678-81751700 AAAAGCGAAGGTCAGTGGTTTGG - Intronic
960116514 3:113900061-113900083 TAAACTGAAGATCAGAGGCTAGG + Intronic
961231682 3:125318402-125318424 TTAATGGAAAGTCAGGGGCTAGG + Intronic
962179482 3:133190711-133190733 AAAGCAGCAGGTCAGGGGCTGGG + Intronic
964040967 3:152261391-152261413 AAAAAGGAAGGACATGGGGTTGG + Intronic
966805769 3:183806276-183806298 AAAACAAAAGGCCAGGAGCTGGG + Intronic
967983242 3:195077941-195077963 AAAACAGATGGGCAGGGACTGGG + Intronic
968055883 3:195691371-195691393 AAAACGGAAGGTCTGGGGTGGGG - Intergenic
969215503 4:5719222-5719244 AAACCCGAAGGTCAGGAGTTGGG - Intronic
970752234 4:19377728-19377750 GAAATGAAAGGTCAGTGGCTTGG - Intergenic
972317081 4:37936712-37936734 ATAAAGGAAGGGCAGGGTCTGGG + Intronic
972599026 4:40555360-40555382 AAACTAGAAAGTCAGGGGCTGGG - Intronic
972726325 4:41748988-41749010 AGAAGGGAGGATCAGGGGCTCGG - Intergenic
973815728 4:54617235-54617257 AAAATGGAAGGTGAGGTGCCGGG + Intergenic
979050694 4:115927885-115927907 AAAAATGAAGGTCATGTGCTTGG + Intergenic
979974573 4:127181155-127181177 GAAAAGGTAGGTCAGGGCCTTGG + Intergenic
980110407 4:128630809-128630831 AAAACTGAAGGCTAGGGGCAAGG + Intergenic
980158629 4:129134604-129134626 AAAACAGAAGGTCATAGACTAGG + Intergenic
980937778 4:139242603-139242625 AAAACCACAGGTCAAGGGCTTGG - Intergenic
980969684 4:139556708-139556730 ACAACGGGAGGTCGGGAGCTCGG - Exonic
984901504 4:184590634-184590656 AAAACGGAAGGGCAGGGGTCTGG + Intergenic
985119827 4:186629228-186629250 AAAACCTATGATCAGGGGCTTGG - Intronic
985486448 5:154297-154319 AAAAAGAAAGGGAAGGGGCTGGG - Intronic
985924096 5:3002174-3002196 ACAAGGGGATGTCAGGGGCTGGG + Intergenic
985962355 5:3312187-3312209 GAACAGGAAGGTCAGGGGCTGGG - Intergenic
985965734 5:3337907-3337929 AACAGGGAAGGTGAGTGGCTGGG + Intergenic
986143070 5:5049833-5049855 AAACAGGTAGGACAGGGGCTGGG - Intergenic
987117912 5:14740795-14740817 ATAACGGGAGCACAGGGGCTGGG - Intronic
993105197 5:83592514-83592536 AAAACTAAATCTCAGGGGCTGGG - Intergenic
995995649 5:118295240-118295262 AAAAGCAAAGGTTAGGGGCTTGG + Intergenic
996434138 5:123415421-123415443 AAAAGGAAAGCTCAGGGGCTAGG + Intronic
998137612 5:139682344-139682366 GAAATGGAAGGGCTGGGGCTGGG - Intronic
998264812 5:140659918-140659940 AAAAGGGAAGGAGAGGGGCAGGG - Intronic
998265314 5:140663730-140663752 AAAAAAGAAATTCAGGGGCTGGG + Intergenic
999476224 5:151901291-151901313 AACACTGAAGGTCAGAGGCATGG - Intronic
1000326712 5:160177856-160177878 AAAATGGAAAGACTGGGGCTAGG - Intergenic
1001044152 5:168358482-168358504 AAAACAGCAGCCCAGGGGCTGGG + Intronic
1001610482 5:172997512-172997534 AAGACTAAAGGTCAGGGGCAAGG + Intronic
1003098413 6:3159112-3159134 AAAACCCAAGGTGATGGGCTGGG + Intergenic
1003217840 6:4131321-4131343 AAAACTGTAGCTGAGGGGCTAGG + Intronic
1004453173 6:15766474-15766496 AAGAGGGAAGCTCAGGAGCTTGG - Intergenic
1004520368 6:16355857-16355879 AAAAGGGTGGGTGAGGGGCTGGG - Intronic
1004547016 6:16607522-16607544 AAAATGGAATGTCAGTGTCTGGG + Intronic
1006591641 6:35162363-35162385 GAAACGGGAGGCCAGAGGCTAGG - Intergenic
1006844026 6:37050405-37050427 AAAACCACAGGTCAGGGGCCAGG + Intergenic
1007165410 6:39825425-39825447 AAAACACAAGGTCGGGGGGTTGG + Intronic
1008279813 6:49583430-49583452 AATATGGCAGGTCAGGGGTTGGG + Intergenic
1013621774 6:111897270-111897292 AAAGGGGAAGGTCATGGACTTGG + Intergenic
1013668647 6:112374583-112374605 AAAAGGGAAGGGTAGTGGCTGGG - Intergenic
1014233567 6:118930841-118930863 AAAACAGAAAGTGAGGGGCAAGG + Intronic
1017241242 6:152171401-152171423 AAAGAACAAGGTCAGGGGCTGGG + Intronic
1019663553 7:2239748-2239770 AGAACGGCAGGTCATGAGCTGGG + Intronic
1020088008 7:5321890-5321912 ATCACCGGAGGTCAGGGGCTCGG - Intronic
1020675975 7:11185570-11185592 GAGAAGGGAGGTCAGGGGCTAGG + Intergenic
1024377445 7:48655752-48655774 AAGACGGAGGGGCAGGGGCTTGG + Intergenic
1025206290 7:56995224-56995246 ATCACCCAAGGTCAGGGGCTCGG + Intergenic
1025665646 7:63581703-63581725 ATCACCCAAGGTCAGGGGCTCGG - Intergenic
1025724224 7:64043053-64043075 AAAAAGGAAGGTGAGTAGCTGGG - Intronic
1025813525 7:64889777-64889799 AAAATGCAAGTGCAGGGGCTTGG - Intronic
1026232853 7:68500347-68500369 AAAAAAGAAGATAAGGGGCTGGG + Intergenic
1028130786 7:87170260-87170282 AAAAAGATAGGTCAGTGGCTTGG - Intronic
1031484768 7:122312879-122312901 CAAAAGGAAAGTCAGGGGCAGGG + Intergenic
1032001896 7:128271157-128271179 AAAAAGCAAGGTCCGGGGCAAGG + Intergenic
1032255148 7:130291252-130291274 AAAAAGGAATGTCATTGGCTTGG - Intergenic
1033248305 7:139737040-139737062 AAAACGGAATGAAAAGGGCTTGG - Intronic
1037956521 8:23064540-23064562 AAGAAGGGAGGTCAGGGGTTTGG + Intronic
1038507880 8:28101461-28101483 AAAAAGGGAGGTGAGGGGCATGG - Intronic
1039043198 8:33427150-33427172 AATACGGAAGCAAAGGGGCTTGG + Intronic
1039162427 8:34637568-34637590 AAAAGGAAAGGTCAGGGGTCGGG + Intergenic
1039976200 8:42367294-42367316 AAAAAGGAAGAACAGGGTCTAGG + Intronic
1040352455 8:46582702-46582724 GAAACTGAAGGTGAGGGGGTTGG - Intergenic
1043412404 8:80011456-80011478 AAAACTAAATGACAGGGGCTAGG + Intronic
1045398901 8:101791430-101791452 AAAACAGAAGCTCAGGGGGAGGG + Intronic
1046455404 8:114453428-114453450 GAAAAGGAAAGTCAGGGACTTGG - Intergenic
1047046865 8:121063450-121063472 AAAACGTAAGTTCTGGGGTTTGG + Intergenic
1047735273 8:127759705-127759727 AAAAGGGAAGGAAATGGGCTTGG - Intergenic
1049342683 8:142121712-142121734 AAAACCGAGGGACAGGGGCACGG + Intergenic
1050846971 9:10233234-10233256 AAGAAGGAAAGTGAGGGGCTTGG + Intronic
1051918741 9:22238537-22238559 TAAAAGGAAGGTAAGGGGCGAGG + Intergenic
1053287299 9:36858363-36858385 GAGACGGAAGATCAGGGACTTGG - Intronic
1053321920 9:37106330-37106352 AAAATAGAAGGTTAGAGGCTGGG - Intergenic
1056723703 9:89093666-89093688 CAAAGGAAAGGACAGGGGCTTGG + Intronic
1057200005 9:93134749-93134771 AAAACCTAAGGTCAGGGAGTGGG - Intergenic
1058981342 9:110173546-110173568 AAAACTGATGGTCAGGGGTCAGG - Intergenic
1059219896 9:112605468-112605490 AAGTAGGAAGGGCAGGGGCTGGG - Intronic
1062317107 9:135973015-135973037 AAAAGGGAAGGACATTGGCTGGG - Intergenic
1062628849 9:137454709-137454731 AGGACGGAAGGTCAGAGCCTGGG - Intronic
1190659778 X:52643510-52643532 AAAACTGGAGGCCAGGTGCTGGG + Intergenic
1193493490 X:82180735-82180757 AAAAAGGAAAGTCAAGGACTGGG - Intergenic
1194719409 X:97323199-97323221 AAAAAGTAAGCTCAGGGGCTGGG - Intronic
1195024464 X:100862340-100862362 ATTATGCAAGGTCAGGGGCTGGG + Intronic
1196548271 X:116991283-116991305 AAAACGGAAGGGAAGGAACTTGG + Intergenic
1197328799 X:125127792-125127814 AAATTGGAAGGTCAAGGACTAGG - Intergenic
1202162874 Y:21953737-21953759 AAAACTGAAGCTAAGAGGCTGGG - Intergenic
1202228482 Y:22632631-22632653 AAAACTGAAGCTAAGAGGCTGGG + Intergenic
1202314675 Y:23563545-23563567 AAAACTGAAGCTAAGAGGCTGGG - Intergenic
1202556126 Y:26107048-26107070 AAAACTGAAGCTAAGAGGCTGGG + Intergenic