ID: 1090371231

View in Genome Browser
Species Human (GRCh38)
Location 11:126254543-126254565
Sequence AGGTCAGGGGCTAGGAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 866
Summary {0: 1, 1: 0, 2: 4, 3: 90, 4: 771}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090371224_1090371231 25 Left 1090371224 11:126254495-126254517 CCATAGATCTTAAAGGGGAACAT 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1090371231 11:126254543-126254565 AGGTCAGGGGCTAGGAGCAGTGG 0: 1
1: 0
2: 4
3: 90
4: 771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090371231 Original CRISPR AGGTCAGGGGCTAGGAGCAG TGG Intronic
900122753 1:1055884-1055906 AGGTCAAGGGGCAGGTGCAGAGG + Exonic
900166708 1:1246884-1246906 AGGACGGGGGCTGGGAGCGGGGG - Intergenic
901082720 1:6592693-6592715 CAGTCAGGGGGTAGGAGCAGGGG + Exonic
901424613 1:9173968-9173990 AGGTAGGGGGCCAGAAGCAGTGG - Intergenic
901601841 1:10428797-10428819 GCCTCAGAGGCTAGGAGCAGTGG - Intergenic
901722107 1:11207386-11207408 AGGTAGGGGGCCAGGTGCAGTGG - Intronic
901895980 1:12312468-12312490 AAGTTAGGGGCTAGGCGCAGTGG + Intronic
902037443 1:13467924-13467946 TGGGCAGGGGCCAGGTGCAGTGG + Intergenic
902074079 1:13768669-13768691 AACTCAAGGGCCAGGAGCAGTGG - Intronic
902417036 1:16245979-16246001 TGGTCATGAGCTTGGAGCAGAGG - Intergenic
902433382 1:16380892-16380914 AGATGAGGGGCTGGGTGCAGTGG - Intronic
902445626 1:16461975-16461997 GGGTCTGGGGCCAGGAGCAAGGG + Intergenic
902875807 1:19340046-19340068 AGGCCAGGGGCTAAGAGGGGAGG + Intronic
902896800 1:19485215-19485237 AGGGCGGGGGCTGGGAGCGGGGG + Intronic
902915166 1:19634109-19634131 AGGATAGGGGCTAAGAGCAGGGG + Intronic
903070896 1:20726621-20726643 AGGGCAGGGAGGAGGAGCAGTGG + Intronic
903841969 1:26249367-26249389 AGATTAGAGGCCAGGAGCAGTGG - Intronic
904489287 1:30848253-30848275 ATGCCACTGGCTAGGAGCAGAGG + Intergenic
904550001 1:31307860-31307882 AGGTCATAGGCCAGGTGCAGTGG - Intronic
904858336 1:33516623-33516645 AGGGGAGGGGCCGGGAGCAGAGG + Intronic
904866079 1:33579964-33579986 TGGTTGGGGGCTAGGTGCAGTGG - Intronic
905275064 1:36812223-36812245 AGGTCAGATGCTAGGAACCGAGG + Intronic
905468631 1:38175270-38175292 AGGACAGTGGCTGGGAGCTGGGG + Intergenic
905534954 1:38714019-38714041 AGGACAGTGGCTGGGGGCAGAGG + Intergenic
905915614 1:41682402-41682424 AATTCAGGGGCTGGGAGCACAGG - Intronic
906311358 1:44756837-44756859 AGATCTGGGGCCAGGTGCAGTGG - Intronic
906614521 1:47225422-47225444 AGGTCAGGGGCCAGGGGCCAGGG - Exonic
906989663 1:50724363-50724385 AGGACGAGGGCTAGGAGCACAGG + Intronic
907227000 1:52957193-52957215 GGGCCAGGGGCCAGGGGCAGTGG - Intronic
907361101 1:53915895-53915917 AGGTGAGGGGCTGAGAGCAGTGG + Intergenic
907371467 1:54006311-54006333 GGGTGAGGAGCTAGGAGAAGAGG - Intergenic
907504449 1:54907627-54907649 AAGGCAGGGGCCAGGTGCAGTGG - Intergenic
907929605 1:58987182-58987204 AGATCAGAGGCTGGGAGGAGAGG - Intergenic
908481223 1:64541518-64541540 AGGTGTGGGGCTGGGAGCAGTGG + Intronic
908771412 1:67600183-67600205 TTGTCAGGGGCTAGGGGAAGAGG - Intergenic
908776013 1:67640775-67640797 TTGCCAGGGGCTAGGAGGAGCGG + Intergenic
909949798 1:81705627-81705649 AGGTGAAGGGCTGGGCGCAGTGG + Intronic
911102949 1:94108273-94108295 AGGTCAAGGGCTAGAAGCAGGGG - Intronic
911256514 1:95639258-95639280 TGGCCAGGGGCTGGGTGCAGTGG + Intergenic
913327756 1:117641877-117641899 AGGGCAGGGGCTAGGGGAACAGG - Intergenic
913351196 1:117861757-117861779 AGTTCAGGAACTAGCAGCAGAGG - Intergenic
913696507 1:121331350-121331372 AGGTCATGTGATAGAAGCAGAGG + Intronic
913958092 1:143321268-143321290 AGGACCGGGGTCAGGAGCAGGGG + Intergenic
914052407 1:144146643-144146665 AGGACCGGGGTCAGGAGCAGGGG + Intergenic
914126790 1:144819898-144819920 AGGACCGGGGTCAGGAGCAGGGG - Intergenic
914141054 1:144948711-144948733 AGGTCATGTGATAGAAGCAGAGG - Intronic
914819548 1:151090229-151090251 AGGCCAGGGGCCAGGTGCACTGG - Intronic
914878671 1:151530810-151530832 AGGACAGGGGCTTGGGGGAGAGG + Intronic
915060866 1:153183372-153183394 AAGTCAGGGGCCAGGCGCGGTGG - Intergenic
915218526 1:154355815-154355837 AGGACTGGGGCAAGGAGGAGAGG + Intergenic
915455951 1:156040922-156040944 AGGCCAGGGGCTGGCAGGAGGGG - Intronic
915508927 1:156375358-156375380 AGGTCTGAGGCTGGGCGCAGTGG - Intronic
915684318 1:157616347-157616369 AGGTCTGGGTCTAGGGACAGAGG + Intergenic
915954967 1:160213697-160213719 GGGTCAGGGGCTAGGGGAGGGGG + Exonic
916572359 1:166038865-166038887 AGGGCCGGGCCCAGGAGCAGGGG - Intergenic
916792900 1:168139360-168139382 TGGTCAGGGGCTGAGTGCAGTGG - Intergenic
917110180 1:171539551-171539573 CTGCCAGGGGCTAGGAGTAGGGG - Intronic
917309010 1:173657748-173657770 AGGCCAGAGGCCAGGTGCAGAGG - Intronic
917617552 1:176761621-176761643 AATTCAGGAGCTAGCAGCAGAGG - Intronic
917927857 1:179803947-179803969 AGGCCAGGGGGCAGGAGGAGGGG - Intronic
918739848 1:188115344-188115366 AGGATAGGGCCTAGGAACAGAGG - Intergenic
919384529 1:196903363-196903385 AAGTCAGGGGCCAGGCGCAGTGG + Intronic
919920894 1:202165861-202165883 AGGTTTGGGGCTAGGTGGAGCGG + Intergenic
920255254 1:204650172-204650194 GGCTCAGGGCCTAGGGGCAGTGG + Intronic
920483834 1:206349703-206349725 AGGTCATGTGATAGAAGCAGAGG + Intronic
921030110 1:211328968-211328990 GGGTGAGGGGCCTGGAGCAGGGG - Intronic
921195785 1:212756530-212756552 GAGTCAGGGGCTGGGCGCAGTGG + Intronic
921864692 1:220076079-220076101 AGATTAGGGGCTGGGCGCAGTGG + Intronic
922230331 1:223680224-223680246 AAGTCAGGGGCTAGCTGCTGGGG - Intergenic
922722910 1:227907793-227907815 TGGTGAGGGGCTGGGAGGAGTGG - Intergenic
923114696 1:230924115-230924137 AGGTAAAGGTTTAGGAGCAGAGG + Intronic
923159924 1:231307010-231307032 AGGTCAGGGGGTAAGACCTGTGG - Intergenic
923229940 1:231976122-231976144 AGGACAGGTGCCAGGAGCAAGGG + Intronic
923346859 1:233062044-233062066 AAGAAAGGGGCTAGGCGCAGTGG - Intronic
923712324 1:236397120-236397142 AGCTCAGTGGCTGGGTGCAGTGG + Intronic
924622246 1:245672258-245672280 TGGTCAGGAGCAGGGAGCAGGGG + Intronic
924726805 1:246678810-246678832 AGATGAGGGGCTGGGCGCAGTGG - Intergenic
1063456447 10:6185925-6185947 AGGACAGGGGCCAGGCGCGGTGG - Intronic
1064144371 10:12815806-12815828 AGGTCCTGGGCTAGGTGCTGTGG - Intronic
1064268420 10:13843784-13843806 AGGAAAGGGGCTGGGTGCAGTGG - Intronic
1064340076 10:14477791-14477813 ATTCCAGGGGCTAGAAGCAGAGG - Intergenic
1064613440 10:17127592-17127614 AGGCCTTGGGCTGGGAGCAGTGG - Intronic
1064811105 10:19199511-19199533 AGGACACGGGCCAGGTGCAGTGG + Intronic
1065282665 10:24155531-24155553 ATGTCAGGGGCCGGGTGCAGTGG + Intronic
1065439321 10:25733693-25733715 TGGTAAGGGGCTGGGCGCAGTGG + Intergenic
1065795531 10:29304046-29304068 TGGTCACGGGCTAGGTGCAGTGG - Intronic
1066269811 10:33811168-33811190 AGGTCAGGGGCACTGAGCTGGGG - Intergenic
1066353824 10:34663037-34663059 GGGTGTGGGGCTGGGAGCAGGGG + Intronic
1067320209 10:45212165-45212187 AGTGCAGGGGCTGGGCGCAGTGG + Intergenic
1067775942 10:49164928-49164950 AGGCCATGGGCTAGGTGCTGGGG - Intronic
1069432243 10:68348207-68348229 AGGACGGGGGCCAGGTGCAGTGG + Intronic
1070208080 10:74284549-74284571 AGATGAAGGGCTGGGAGCAGTGG - Intronic
1070726913 10:78798417-78798439 GGGTTAGGAGCTAGGAGCACGGG + Intergenic
1071514739 10:86289689-86289711 AAGTCATGGACTAGGAGTAGAGG - Intronic
1072140690 10:92586568-92586590 AGGTCAAGGGCCAGGCGCGGTGG + Intergenic
1072333813 10:94379601-94379623 AGATGAGAGGCTAGGTGCAGTGG + Intergenic
1072690407 10:97569108-97569130 AGGTCTGTGGCCAGGCGCAGTGG - Intronic
1073060981 10:100733494-100733516 AGGCCAGGGCCTAGGCTCAGGGG - Intergenic
1073211219 10:101804558-101804580 ATGTAAGGGGCCAGGCGCAGTGG - Intronic
1073597788 10:104817587-104817609 AGGGAAGGGGATAGGAGGAGGGG - Intronic
1074096630 10:110318952-110318974 AGGTCAAAGGCTAGGAAAAGGGG - Intergenic
1074245067 10:111681325-111681347 AGGTCCAGGGCCAGGTGCAGTGG - Intergenic
1074561461 10:114539068-114539090 AGGTATGGGGCTGGGCGCAGTGG + Intronic
1074932789 10:118146140-118146162 AGGGCAGTGGAGAGGAGCAGAGG - Intergenic
1075064309 10:119279165-119279187 AGGTCAGGGGCCAGGCGCAGTGG - Intronic
1075083487 10:119399021-119399043 AGGTCAGGGGCTGCCAGCAGGGG - Intronic
1075153083 10:119952730-119952752 AGGCCAGTGGCTAAGAGCACAGG + Intergenic
1075584669 10:123648919-123648941 ATGTCAGGGGGCAGGAACAGGGG - Intergenic
1075589040 10:123678300-123678322 AGCTCAAGGTCTAGGAGGAGGGG - Intronic
1075870547 10:125769858-125769880 AGATCAGGGCCTGGGTGCAGTGG + Intronic
1075971588 10:126658878-126658900 AGGGAAAGGGCTAGGAGCAATGG - Intronic
1076935897 10:133567433-133567455 GGGTCAGGGGTTAGGGGTAGGGG + Intronic
1076981407 11:206953-206975 AGGCCAGGCCCTAGGAGTAGAGG - Intronic
1077177980 11:1199212-1199234 AGGGCAGGGTCTGGGAGCACTGG + Intronic
1078023739 11:7674709-7674731 AGGAGAGGGGCTAGGAGAAGGGG + Intronic
1078200909 11:9182030-9182052 AATTTAGGGGCCAGGAGCAGTGG + Intronic
1078211859 11:9276295-9276317 AGATCTGGGACCAGGAGCAGTGG - Intergenic
1078392085 11:10944093-10944115 AGCTCAGGGAGTAGGAGAAGGGG - Intergenic
1079065955 11:17292964-17292986 TTGTCAGCGGCTAGGTGCAGTGG + Intronic
1079375454 11:19887907-19887929 ACTTCAGAGGCTGGGAGCAGAGG - Intronic
1079650460 11:22922062-22922084 ACTTCAAGGGCCAGGAGCAGTGG - Intergenic
1079751833 11:24209483-24209505 AGGGTAGGGGCTTGGAGGAGGGG + Intergenic
1080627473 11:34043547-34043569 TAGCCAGGGGCTAGGAGGAGGGG + Intergenic
1080651829 11:34228830-34228852 ATCTCAGGGGCCAGGTGCAGTGG + Intronic
1080671284 11:34381013-34381035 AGGTCAGGGGCCAAGGGCTGAGG + Intergenic
1081446678 11:43137613-43137635 TTGTCAGGGGCTAGGAGAAGAGG + Intergenic
1081810066 11:45909570-45909592 AGTTCAGGGGGTATGAGCTGGGG - Intergenic
1081910488 11:46696929-46696951 AGGACAGGAACTAGCAGCAGGGG + Intronic
1081911876 11:46705091-46705113 AGGGCATGGGCAAGGGGCAGGGG - Exonic
1082003208 11:47405630-47405652 AAGACAGAGGCTAGGTGCAGTGG + Intergenic
1082006750 11:47423497-47423519 GGGCCAGGGGCTGGGAGCAGTGG + Intronic
1082068379 11:47919004-47919026 AGGACAGGGGCTGGGTGCAGTGG - Intergenic
1082795624 11:57376359-57376381 ACGTGAGGGGTTAGGAGTAGGGG - Intergenic
1082963994 11:58947182-58947204 AGGTCAGGGTATGGGAGTAGGGG + Intronic
1083174118 11:60938742-60938764 AGGTGAGTGGGTAGGAGGAGCGG - Intronic
1083431747 11:62616878-62616900 GGGTGAGGGGCTGGAAGCAGTGG - Intronic
1083636194 11:64122321-64122343 AGGTCCGGAGCCAAGAGCAGGGG + Intronic
1083665754 11:64273591-64273613 AGGTGGGGGGCTGGGCGCAGTGG + Intronic
1083877788 11:65533489-65533511 TGGTCAGGGGCTGGGCGCAGTGG + Intronic
1084085482 11:66853112-66853134 AGGGCAGGGGTGAGGGGCAGGGG + Intronic
1084091463 11:66881759-66881781 AGGTAAGGGACCAGGTGCAGTGG + Intronic
1084221008 11:67679178-67679200 AAATCAGGGGCCAGGTGCAGTGG + Intronic
1084322504 11:68381491-68381513 AGGCCAGGGGCTTGGGGCAAGGG - Intronic
1084931319 11:72558696-72558718 AGTCCAGGGGCTGGGCGCAGTGG + Intergenic
1084937567 11:72595289-72595311 AGGTGAGGGGCTGTGTGCAGAGG - Intronic
1084949033 11:72654563-72654585 ATGTCTGGTGCTAGGAGCAGTGG - Intronic
1085013371 11:73156825-73156847 GCCTCAGGGGCTAGGACCAGAGG + Intergenic
1085312894 11:75526324-75526346 GGGTCACGGGGAAGGAGCAGGGG + Intergenic
1085446016 11:76601421-76601443 TGGTCACAGGCTAGGTGCAGTGG - Intergenic
1085451881 11:76639049-76639071 AGCTCAGGGGCTGGAGGCAGGGG - Intergenic
1086415599 11:86586267-86586289 AGGTTAGTGGGTAGGAGCAATGG + Intronic
1087022742 11:93619515-93619537 AGGTCAGGGGGAAGCAGGAGAGG + Intergenic
1087538046 11:99477660-99477682 AGATCAGGGGCCGGGTGCAGTGG + Intronic
1088400934 11:109422384-109422406 AGGGCAGGGGCCGGGGGCAGGGG - Intronic
1089016034 11:115166318-115166340 GGGCCAGGGGCCAGGGGCAGTGG + Intergenic
1089176633 11:116553271-116553293 AGGTCAGTGGCTTTGAGGAGGGG + Intergenic
1089188905 11:116640183-116640205 TTGTCAGGGGCTAGGGGAAGAGG - Intergenic
1089539306 11:119180415-119180437 AGTTTAGGGGCCGGGAGCAGTGG + Intronic
1090371231 11:126254543-126254565 AGGTCAGGGGCTAGGAGCAGTGG + Intronic
1090718617 11:129452630-129452652 AAGTCTTGGGCTGGGAGCAGTGG + Intergenic
1090836191 11:130455789-130455811 AGGTGTGGGGCAAGGAGCCGGGG + Intronic
1091152212 11:133339406-133339428 AGGTGAGTGGCTAAGAGCATGGG - Intronic
1091315436 11:134610947-134610969 AGCTCAGGGGCTTGGAGAAGGGG - Intergenic
1091371603 11:135064973-135064995 AGGGCAGGGGTGAGGAACAGAGG - Intergenic
1091383157 12:76009-76031 TGGTCAGAGGCTGGGGGCAGAGG - Intronic
1091599961 12:1912151-1912173 AGGCCAGGGCCAAGCAGCAGGGG - Intronic
1091777608 12:3194828-3194850 AGGGCAGGGGCTAGGAGATTGGG - Intronic
1091981362 12:4866659-4866681 AGGGCAGGGGCTCAGAACAGGGG + Intergenic
1092219983 12:6706449-6706471 AAAACAGGGGCTAGGAGCTGTGG - Intergenic
1092384020 12:8021628-8021650 AGGGAAGGGGCCAGGCGCAGTGG - Intergenic
1092526140 12:9311397-9311419 TAGTCAGGGACTGGGAGCAGTGG - Intergenic
1092669920 12:10851391-10851413 AGGTCAGCGAGAAGGAGCAGAGG + Intronic
1092863970 12:12743854-12743876 AGGAAAGGGGCTAGGAGCCCAGG + Intronic
1092900733 12:13057263-13057285 AGGTCACAGGCTGGGTGCAGTGG - Intronic
1095039074 12:37422418-37422440 AGGACTGGGGCTCGGTGCAGGGG - Intergenic
1095909812 12:47414736-47414758 AGGTCAGGGACTAGTGGCACCGG - Intergenic
1095943627 12:47741303-47741325 AGGGCAGGGGCTGGTAGCACTGG - Intronic
1096119222 12:49076414-49076436 AAGTTTGGGGCCAGGAGCAGTGG + Intergenic
1096369524 12:51057382-51057404 AGGTGAGGAGCTGGGCGCAGTGG - Intronic
1096402295 12:51317378-51317400 AGTATAGGGGCTAGGCGCAGTGG + Intronic
1096514759 12:52149716-52149738 AGGACAGGGGGCAGGAGGAGGGG - Intergenic
1096542045 12:52313391-52313413 AGGCCAGGGGCTGGGTGAAGGGG + Intergenic
1096756910 12:53807272-53807294 ATGTCATGGGCTAGGAGGAAGGG - Intergenic
1096981627 12:55731071-55731093 AGAGGAGGGGCTAGGCGCAGTGG + Intergenic
1097063908 12:56306178-56306200 AGGACAGGGGCCAGGTGCAGTGG - Intronic
1097248913 12:57621664-57621686 AGGGCAGGGGCGATGAGCAGAGG - Intronic
1097363965 12:58690800-58690822 AAATCAAGGGCTGGGAGCAGTGG + Intronic
1097437070 12:59562977-59562999 AAGGCAGAGGCTAGGCGCAGTGG - Intergenic
1097678442 12:62627034-62627056 AGATAATGTGCTAGGAGCAGGGG + Intergenic
1097872711 12:64614413-64614435 AGATCAGGGGCCAGGTGCGGTGG - Intronic
1098268956 12:68751579-68751601 AAGACCGGGGCCAGGAGCAGTGG - Intronic
1098840790 12:75475771-75475793 AGGGAAAGGGCTAGGCGCAGTGG + Intergenic
1100317887 12:93462204-93462226 AAGTCTGGGGCCAGGTGCAGTGG - Intergenic
1100985514 12:100199250-100199272 GGGTCAGAGGGAAGGAGCAGAGG + Intronic
1101118120 12:101551830-101551852 GGGTGAGGGGCGAGGGGCAGGGG - Intergenic
1101380853 12:104212698-104212720 AGGTTAGTGGTTAAGAGCAGAGG + Intergenic
1101610546 12:106287410-106287432 AGGTAAGGGGCTAGGAAGGGTGG + Intronic
1102191960 12:110995354-110995376 AGGAGAGGGGCTGGGTGCAGGGG + Intergenic
1102590929 12:113956291-113956313 AGGGCTGGGGCCAGGTGCAGTGG + Intronic
1102657477 12:114494664-114494686 AGGACAGGGGCTGGAAGCAAGGG + Intergenic
1103013830 12:117478740-117478762 AAGTTCAGGGCTAGGAGCAGTGG - Intronic
1103214126 12:119188533-119188555 AGTTTAGGGGCCAGGCGCAGTGG - Intronic
1103587795 12:121969020-121969042 AGCGCAGGGGCTTGGAGAAGTGG - Intronic
1103900797 12:124302794-124302816 AGGTCAGGGGCTGAGGTCAGGGG + Intronic
1103969208 12:124659534-124659556 AGGTGAGGGGTCAGGAGCTGAGG - Intergenic
1104007363 12:124903148-124903170 AAGTTAGGGGCCAGGCGCAGTGG + Intergenic
1104895411 12:132161402-132161424 AGGTGAGGGACGAGGAGCTGAGG - Intergenic
1104937743 12:132375470-132375492 AGGGCTGGAGATAGGAGCAGGGG - Intergenic
1104983805 12:132585651-132585673 AGGGCAGGAGCCAGGTGCAGAGG + Intergenic
1106040759 13:26089419-26089441 AGGGCATTGGCTGGGAGCAGTGG - Intergenic
1106218130 13:27721190-27721212 TTGCCAGGGGCTGGGAGCAGAGG + Intergenic
1106739645 13:32626125-32626147 TGGTCTGGGGCTGGGTGCAGTGG - Intronic
1107344176 13:39441271-39441293 AAGGCAGGGGCCAGGTGCAGCGG - Intronic
1107889829 13:44904417-44904439 AGGTCAGAGGCTGGGAGCTGGGG - Intergenic
1109977589 13:69859377-69859399 AGGTCAGGGGGTGAGAGGAGAGG + Intronic
1111216811 13:85153954-85153976 AGGTGAGGGGCTAGCAACAACGG - Intergenic
1111298696 13:86318149-86318171 TGACCAGGGGCCAGGAGCAGTGG + Intergenic
1112271349 13:97973327-97973349 AACTCAGGGGCTGGGTGCAGTGG - Intronic
1112596905 13:100815865-100815887 AGGCCAGATGCCAGGAGCAGGGG - Intergenic
1112651979 13:101409455-101409477 TGGCCAGGGGCTGGGAGGAGGGG - Intronic
1113587164 13:111473328-111473350 AGGGCAGGGACTGAGAGCAGGGG + Intergenic
1114027948 14:18545672-18545694 CGATCATGGGCCAGGAGCAGAGG + Intergenic
1114674602 14:24431858-24431880 TGGGCAGGGGCCAGGAGCACTGG + Exonic
1114968780 14:28000214-28000236 AAGTTAGGGGCCAGGCGCAGTGG - Intergenic
1115273593 14:31581733-31581755 AAGTCTGGGGCTTGGAGGAGAGG + Intronic
1117224966 14:53647218-53647240 GGGGCAGGGGCTTGGAACAGTGG - Intergenic
1117250255 14:53929616-53929638 TAGTCTGGGGCTGGGAGCAGTGG - Intergenic
1118551165 14:66952199-66952221 TTGTCAGGGGCTGGGGGCAGAGG - Intronic
1118836138 14:69479327-69479349 AAGTCAGGAGGTAGGAGCTGGGG + Intergenic
1119404802 14:74391102-74391124 AGGAAAGGGGCTGGGGGCAGTGG - Intergenic
1119407417 14:74407338-74407360 TGCTCTGGGGCTGGGAGCAGCGG + Exonic
1119855979 14:77901335-77901357 AGCTCCAGGGCCAGGAGCAGTGG - Intronic
1119938023 14:78610986-78611008 AGGCCAAGGGCCAGGGGCAGGGG - Intronic
1119973762 14:79002365-79002387 CTGTCAGGGGATAGGATCAGAGG - Intronic
1121141439 14:91545847-91545869 AAATCCGGGGCTGGGAGCAGTGG - Intergenic
1121205633 14:92164015-92164037 AGATCTTGGGCCAGGAGCAGTGG - Exonic
1121226402 14:92324356-92324378 AGGGCAGGGGCGAGACGCAGTGG - Intronic
1121267323 14:92612703-92612725 AGGGCAGGGGCTGGGGCCAGGGG + Intronic
1121348993 14:93157670-93157692 AGATCAGAGGCTGGGCGCAGTGG + Intergenic
1121352055 14:93181474-93181496 TGGTCAAGGGCTGGGCGCAGTGG - Intergenic
1122510404 14:102262126-102262148 AGGCCAGGGGCTGGGCGCGGTGG - Intronic
1122557636 14:102590302-102590324 AGGCCACGGGCTAGGAGCCCAGG + Intergenic
1122633852 14:103121309-103121331 AGGCCAGGGGCAGTGAGCAGGGG - Intergenic
1122645758 14:103192593-103192615 AGGTCAGGAGATAGGGACAGAGG + Intergenic
1122854019 14:104551565-104551587 AGGGCAGGGGCCGGGAGCAGGGG + Intronic
1123021375 14:105399283-105399305 AGATCTGGGGGTAGGAGCAGGGG - Exonic
1123111292 14:105868155-105868177 GGGTCTGGGCCTAGAAGCAGGGG + Intergenic
1124095830 15:26648143-26648165 GGGGCTGGGGCTAGGGGCAGGGG - Intronic
1124110932 15:26786033-26786055 ATGTTAAGGGCTAGGTGCAGTGG - Intronic
1124596453 15:31095754-31095776 AAGCCAGGGGCCAGGCGCAGTGG + Intronic
1125243177 15:37600374-37600396 AGGGCACGGGCTGGGAGCTGTGG - Intergenic
1125299115 15:38235485-38235507 ATGACAGGGGCCAGGCGCAGTGG + Intergenic
1125395320 15:39241240-39241262 TTGGCAGGGGCTGGGAGCAGAGG - Intergenic
1125404227 15:39336092-39336114 AGTTTACGGGCTAGGCGCAGTGG - Intergenic
1125614851 15:41001578-41001600 AGGTCATGGGTTAGGAGGAAGGG + Intronic
1125741563 15:41968575-41968597 AGATGAGGGGCCAGGTGCAGTGG - Intronic
1125882674 15:43207911-43207933 AGGCCAGGGGCTTACAGCAGAGG - Intronic
1126170266 15:45689705-45689727 AGGTAAGGGGCCAGGAGCGGTGG - Intronic
1126282168 15:46966283-46966305 AGGAGAGGGGCCAGGCGCAGTGG + Intergenic
1127090883 15:55465851-55465873 AGAACATGGGCCAGGAGCAGTGG - Intronic
1127097539 15:55527546-55527568 TTGTCAGAGGCCAGGAGCAGTGG + Intergenic
1127453247 15:59136757-59136779 AGGTCAGGGGCTGGGGGCTGGGG - Exonic
1127661313 15:61102493-61102515 ATGTCAGGGGCCTGGAGCAGAGG - Intronic
1127846101 15:62872732-62872754 AAATTAGAGGCTAGGAGCAGTGG - Intergenic
1127891339 15:63254187-63254209 AGGCAAAGGGCTAGGAGCTGCGG - Intronic
1128008282 15:64266361-64266383 AGGTCAGGGGCTGGGTGTGGTGG - Intronic
1128461622 15:67872826-67872848 AGTTTAGGGGCTAGGCACAGTGG - Intergenic
1128461636 15:67872942-67872964 AGTTTAGGGGCTAGGCACAGTGG - Intergenic
1129160979 15:73747711-73747733 AGCTCAGGGGCTATGAGCATGGG - Intronic
1129231582 15:74199927-74199949 TGGTTAGTGGCTGGGAGCAGTGG + Intronic
1129485205 15:75863925-75863947 AAGTGAGGGGCCAGGTGCAGTGG - Intronic
1129627345 15:77215774-77215796 AGATCATTGGCTAGGTGCAGGGG - Intronic
1129640908 15:77377095-77377117 AGATAAGGGGCTGGGGGCAGTGG + Intronic
1129756445 15:78101873-78101895 AGGTGAGGGAGTAGGAGCAAAGG - Intronic
1129913759 15:79249653-79249675 AGGTACTGGGCCAGGAGCAGTGG - Intergenic
1130928283 15:88401430-88401452 AGGACAGCGGCCAAGAGCAGAGG - Intergenic
1131252415 15:90839191-90839213 AGGTTTGGGGCTGGGTGCAGTGG - Intergenic
1132154748 15:99487435-99487457 ATGGCAGGGGCCAGGGGCAGGGG + Intergenic
1132279786 15:100602771-100602793 CGGTCCAGGGCTCGGAGCAGGGG - Exonic
1132580567 16:682932-682954 AGGTCAGTGGCTGGCAGGAGAGG - Exonic
1132713788 16:1280522-1280544 AGGTCGGGGGCCGGGGGCAGCGG + Intergenic
1132776326 16:1596777-1596799 GAGTCAGGGGTGAGGAGCAGAGG - Intronic
1132901411 16:2256785-2256807 GGGTCTGGGGCTAAGAGAAGTGG + Intronic
1132942803 16:2516547-2516569 AGGCCAAGGGCCAGGAGCTGGGG - Intronic
1133030943 16:3010862-3010884 AGGTGAGGGGCACTGAGCAGGGG + Intergenic
1133338932 16:5024290-5024312 TGGTCAGGGGCCAGGCGCAGTGG + Intergenic
1133978038 16:10614124-10614146 AACTCAGGGGCTAGGTGCGGTGG + Intergenic
1134016599 16:10892643-10892665 AGTTAAGGGGCTGGGTGCAGTGG + Intronic
1134081905 16:11330645-11330667 TTGTCAGGGGCTGGGAGCAGGGG - Intronic
1134122792 16:11596679-11596701 AGGGGAGGGGGAAGGAGCAGGGG + Intronic
1134187601 16:12096939-12096961 AGGTTAAGGGCTCGGTGCAGGGG + Intronic
1134197207 16:12168488-12168510 AGGTGGGGACCTAGGAGCAGAGG - Intronic
1134232260 16:12438133-12438155 AGGTGAGGGGGCAGGAGTAGGGG + Intronic
1134250158 16:12568687-12568709 AGGTGAGGGGCCAGCGGCAGTGG - Exonic
1134748422 16:16605877-16605899 TGCTCAGAGGCTGGGAGCAGTGG - Intergenic
1134997043 16:18747742-18747764 TGCTCAGAGGCTGGGAGCAGTGG + Intergenic
1135059757 16:19261126-19261148 ATGTCAGGGGCCAGGTGCAGTGG - Intronic
1135135144 16:19881894-19881916 AGGTCAGGAGCTGGGAGAAATGG - Intronic
1135209920 16:20516440-20516462 GGGACAGGGGGTAGGAGGAGTGG - Intergenic
1136002710 16:27307096-27307118 ATGTCAGGGGCTGGGTGCAGTGG + Intergenic
1136032564 16:27514286-27514308 AGGGCAGGGGCCTGGAGCACAGG - Intronic
1136230190 16:28881126-28881148 AGACCAGGGGATAGGACCAGAGG - Intronic
1137486784 16:48897933-48897955 AGGTCAGGGGAGAAGTGCAGAGG + Intergenic
1137631557 16:49949641-49949663 TGGTAGGGGGCTAGGAGCGGTGG + Intergenic
1137773576 16:51037709-51037731 TTGCCAGGGGCTAGGAGGAGGGG - Intergenic
1138424053 16:56918623-56918645 AGGTCAGGGGCCAGGGACTGAGG + Intergenic
1139401725 16:66687376-66687398 AATTCAAGGGCTGGGAGCAGTGG + Intronic
1139455576 16:67072998-67073020 AAGTAAGGGGCTAGATGCAGTGG - Intronic
1141148653 16:81549396-81549418 AGGTCAGGAGCCAGCAGCCGAGG + Intronic
1142480054 17:213620-213642 AGGTCGGGGGCTGAGGGCAGTGG + Exonic
1142522864 17:517385-517407 AGGGCAGGGGCACAGAGCAGTGG + Exonic
1142525578 17:537973-537995 AGGCCAGGAGCCAGGCGCAGGGG + Intronic
1142814976 17:2418301-2418323 TGGTCAGAGGCTGGGAGTAGTGG + Exonic
1142880608 17:2880056-2880078 AACTGAGGGGCTGGGAGCAGGGG + Intronic
1143478874 17:7217525-7217547 CGGCCAGGGGCTAGGGGCCGTGG + Intronic
1143501916 17:7344122-7344144 AGGTGAGGGGCCAGGTGCGGTGG + Exonic
1144664910 17:17095799-17095821 AGCTCAGGGCCTGGGGGCAGAGG - Intronic
1145092176 17:19995098-19995120 AGGGCCGGGGCTGGGCGCAGTGG - Intergenic
1145218894 17:21072739-21072761 GGGACAGGAGCTGGGAGCAGGGG - Intergenic
1145936070 17:28715620-28715642 AGGTAAGGGGCTGGGTGAAGTGG - Exonic
1145985383 17:29042686-29042708 AGGTCAGGGGGTAGAGGCAGGGG - Intronic
1146382314 17:32340351-32340373 AGGGCTGGGGCCGGGAGCAGTGG + Intronic
1146702416 17:34972932-34972954 TGGGCAGGGGCCAGGTGCAGTGG + Intronic
1146937949 17:36824204-36824226 AGGCCTGGGGCAGGGAGCAGAGG - Intergenic
1146952850 17:36918802-36918824 AGGTCAGGGGCTAGCTGGAAAGG - Intergenic
1147346392 17:39798790-39798812 AGGACAGTGGCCAGGCGCAGTGG - Intronic
1147630948 17:41931180-41931202 AGGGCAGGGGGCAGGCGCAGTGG - Intronic
1147771156 17:42868451-42868473 GGGTCAGGGGCGTGGAGAAGTGG - Intergenic
1147806159 17:43133333-43133355 AGGGCAGGGGACAGGAGAAGTGG + Intergenic
1147817759 17:43222452-43222474 AGGAAAGGGGCCAGGCGCAGGGG - Intergenic
1147904659 17:43815044-43815066 AGTTAAGGGGCTGGGTGCAGTGG + Intronic
1148019222 17:44542423-44542445 AGGGCAGGGGTTGGAAGCAGAGG - Intergenic
1148036835 17:44669981-44670003 AGGAAAGGGGCTGGGTGCAGTGG + Intronic
1148055058 17:44789227-44789249 AAAATAGGGGCTAGGAGCAGTGG - Intergenic
1148086156 17:44995031-44995053 AGGGCAGAGGCTGGGAGCAAGGG + Intergenic
1148127475 17:45244243-45244265 AGGTGAGGGGCCAGGAGGTGGGG + Exonic
1148196190 17:45715088-45715110 AGAGCAGGGGCAAGGGGCAGGGG + Intergenic
1148475250 17:47924415-47924437 AGGTCACAGGCTAGGTACAGTGG - Intronic
1148525718 17:48331362-48331384 AGGTAAGAGCCTAAGAGCAGAGG - Intronic
1149223513 17:54441731-54441753 CTGTCAGGGGGTAGGGGCAGGGG + Intergenic
1149363906 17:55921589-55921611 AGGTGAGGGGTTAGGAGAGGAGG + Intergenic
1149811479 17:59677993-59678015 TTGTCAGGGGCTGGGAGGAGGGG - Intronic
1150398742 17:64840304-64840326 AGGGCAGGGGACAGGAGCGGTGG - Intergenic
1150804419 17:68308014-68308036 AAGTAAGGGGCTAGGTACAGTGG + Intronic
1150885288 17:69078482-69078504 AAGTAAGGGGCCAGGTGCAGTGG - Intergenic
1150902303 17:69294233-69294255 AAGACAGGGGCTGGGCGCAGTGG + Intronic
1151307652 17:73273524-73273546 AAGTCAGCGGCCAGGCGCAGTGG - Intergenic
1151523339 17:74646753-74646775 AGTGCAGGGGCCAGGTGCAGTGG + Intergenic
1151562587 17:74878494-74878516 AGGAGAGGGCCTATGAGCAGGGG + Intronic
1151683099 17:75631944-75631966 AGGACAGAGGGGAGGAGCAGAGG - Intronic
1151687339 17:75655967-75655989 AGCTCTGGGGCCAGGAGCAGTGG - Intronic
1151709008 17:75789621-75789643 AGGTCACAGGCCAGGCGCAGTGG - Intronic
1151764574 17:76125539-76125561 AAGTCAGGGGCTGGGTGCAGTGG + Intergenic
1151873304 17:76851017-76851039 GGGGCAGGGGCCAGGCGCAGTGG + Intergenic
1152101316 17:78303491-78303513 GGGGCAGGGGCTGGGGGCAGGGG - Intergenic
1152484902 17:80584050-80584072 AGGTCAGGGGCATGGCGCAGGGG + Intronic
1153051763 18:907503-907525 AGGACTGGGGGTGGGAGCAGAGG - Intronic
1153174380 18:2354477-2354499 TGGCCAGGGGCTTGGAGGAGGGG - Intergenic
1153906296 18:9664613-9664635 TTGTCAGGGGCTAGGGGCAGTGG - Intergenic
1153911110 18:9707806-9707828 AGGACAGGGGTGAGGAGAAGGGG - Intergenic
1155000550 18:21681847-21681869 AGGACAGGGGCCAGGTGCAGTGG + Intronic
1156147513 18:34203247-34203269 AGATCAGTGGTTAGGAACAGGGG + Intronic
1156183890 18:34639126-34639148 ATGCCTGGGGCCAGGAGCAGTGG - Intronic
1156602274 18:38623300-38623322 AGGACAGGGTCTAGAAGCAATGG + Intergenic
1157168574 18:45381501-45381523 AGGTCAGGATCTAGAAGCAAAGG - Intronic
1157283914 18:46364233-46364255 AGGTCAGGGGCCTGGCACAGTGG - Intronic
1157338371 18:46757172-46757194 AGGGCAGGGGCTGGGCGCGGTGG + Intronic
1157808042 18:50672803-50672825 GAGTCAGGGGCTTGGAGTAGTGG + Intronic
1158194755 18:54872336-54872358 AGCTCAGGGGCCAGGCACAGTGG + Intronic
1158708512 18:59816598-59816620 TGGTCAGGGGCTGGGCGCAGTGG + Intergenic
1158852036 18:61504216-61504238 AGGGCAGAGACTAGGAGCAGGGG + Intronic
1158879556 18:61764097-61764119 TTGCCAGGGGCTAGGAGCAGGGG + Intergenic
1158991381 18:62872403-62872425 AGGTCAGAGGCCAGATGCAGTGG + Intronic
1159574970 18:70164048-70164070 CTGTCAGGGGCTGGGAGAAGGGG + Intronic
1160698215 19:494690-494712 AGGGGAGGGGCTGGGTGCAGAGG - Intronic
1161264178 19:3356234-3356256 AAATAAGGGGCCAGGAGCAGTGG - Intergenic
1161494864 19:4581337-4581359 AGGTCAGGCGCTAGGACTGGGGG - Intergenic
1161585029 19:5101369-5101391 AAGTGAGGGACTAGGTGCAGTGG + Intronic
1161623938 19:5314825-5314847 AGATCAGGGGCTTAGATCAGGGG + Intronic
1161923650 19:7285025-7285047 GGGTCTGGGGCCAGGTGCAGTGG + Intronic
1162525287 19:11203170-11203192 AGGGCTGGGGACAGGAGCAGGGG - Intronic
1162827282 19:13260936-13260958 AGGTAAGAGGCCAGGTGCAGTGG - Intronic
1163084426 19:14969125-14969147 AGGTTATGGGCCAGGCGCAGTGG - Intronic
1163140995 19:15348539-15348561 AGGGCTGGGGCCAGGTGCAGTGG + Intergenic
1163284573 19:16338441-16338463 TGGCCAGGGGCAAGGGGCAGAGG - Intergenic
1163365135 19:16871683-16871705 ATGTCAGGGGCTCGGGGCAGGGG - Intronic
1163517231 19:17772402-17772424 AGGTCAGGGCCAAGAAGAAGTGG - Intronic
1163523254 19:17804842-17804864 AGGTGAAGGGCTGGGTGCAGTGG - Intronic
1163623597 19:18375042-18375064 TGGACAGGGGCCAGGCGCAGTGG + Intronic
1163750955 19:19077367-19077389 GTGCCAGGGGCTGGGAGCAGGGG - Intronic
1163775938 19:19217697-19217719 AAGTGAGGGGCTAGGCACAGTGG + Intronic
1164472721 19:28549616-28549638 AGGTCGGGGGCAACAAGCAGTGG - Intergenic
1165123162 19:33576021-33576043 AGTTCAGGGGCCAGGCGCAGTGG + Intergenic
1165323419 19:35100035-35100057 AGATCAGGCGCCAGGAGCCGTGG + Intergenic
1165325504 19:35112174-35112196 AGGTCAGGGGGTAGGTGCGATGG + Intergenic
1165601471 19:37058493-37058515 AGGGCTGGGGCTGGGTGCAGGGG + Intronic
1165737240 19:38184463-38184485 AGGACAGGGGCCGGGCGCAGTGG - Intronic
1165808343 19:38595820-38595842 AGGACAGGGGCAAGGCCCAGAGG + Intronic
1165867781 19:38949669-38949691 AGGACAGGGGCCAGGCGCGGTGG - Intronic
1166102323 19:40578110-40578132 AGGTCAGGGTCTAGGTGTGGGGG - Intronic
1166124435 19:40705290-40705312 AGGTCAGGGGTCAGGAGTCGAGG + Intronic
1166328385 19:42065140-42065162 AGGCCAGAGGCCAGGGGCAGAGG + Intronic
1167148056 19:47694445-47694467 AGGTGGGGGGCTGGGGGCAGCGG - Exonic
1167172652 19:47843488-47843510 GGATCAGGGGCTGGGTGCAGTGG + Intergenic
1167408803 19:49332872-49332894 AGCTGAGGGGCTGGGCGCAGTGG + Intergenic
1167423515 19:49417382-49417404 AGGACAGGAGCTGGGATCAGTGG - Exonic
1167458306 19:49610432-49610454 AGGTCAGTGGCTGAGTGCAGTGG + Intronic
1167679888 19:50912687-50912709 AAGTGGGGGGCCAGGAGCAGAGG + Intergenic
1167729346 19:51241994-51242016 AGATCCTGGGCTAGGTGCAGTGG - Intronic
1167811312 19:51833693-51833715 AGGTCAGGGAATAGGAGAACTGG + Intergenic
1168026285 19:53646101-53646123 AAATCTGGGGCTGGGAGCAGTGG - Intergenic
1168367328 19:55799710-55799732 AAGTGAGGGGCTGGGTGCAGTGG + Intronic
1168653924 19:58113026-58113048 GGGTCAAGGGCCAGGCGCAGTGG + Intronic
1202691805 1_KI270712v1_random:99067-99089 AGGACCGGGGTCAGGAGCAGGGG + Intergenic
925281166 2:2686217-2686239 GGGAAAGGGGCGAGGAGCAGAGG + Intergenic
925704170 2:6668430-6668452 AACTCATGGGCAAGGAGCAGTGG - Intergenic
926055283 2:9770799-9770821 AGGGCCGGGGCAGGGAGCAGGGG - Intergenic
926326808 2:11792186-11792208 AGGTCAGGAGCCAGCAGCATAGG + Intronic
926530421 2:14038298-14038320 AGTTCAGAGGCTGGGCGCAGTGG + Intergenic
926765412 2:16319288-16319310 TGGTCAGGGGCGAGGAGCGCTGG - Intergenic
927500835 2:23582050-23582072 ACGCCAGGGTCTAGGAGCAAAGG + Intronic
927695252 2:25235470-25235492 AGTCTAGGGGCCAGGAGCAGTGG - Intronic
928086216 2:28347937-28347959 AGGTGACAGGCAAGGAGCAGTGG + Intergenic
928125368 2:28611851-28611873 ATGTCAGGGGCTGGGCGCAGTGG + Intronic
928199586 2:29239191-29239213 AGGCCCTGGGCTAGGAGCTGAGG - Intronic
928261319 2:29769529-29769551 AGGCCTGGGGCTAGGTGCTGAGG - Intronic
928516277 2:32047765-32047787 AAGTCAGAGGCCAGGAACAGTGG + Intergenic
928596186 2:32861465-32861487 AACTCAGGGGTTAGGCGCAGTGG - Intergenic
928955837 2:36866352-36866374 AAGTCAGTGGCTGGGTGCAGGGG - Intronic
929120268 2:38478497-38478519 AGTTTAGGGGCCAGGTGCAGTGG + Intergenic
929139062 2:38651468-38651490 AGGCCAGGGGCTGGGCACAGTGG + Intergenic
929556290 2:42927555-42927577 AGGCCAGAGGCCAGGAGCAGAGG + Intergenic
929681678 2:43998236-43998258 AGAGCAGGGGGTAGGAGTAGAGG + Intergenic
929934804 2:46286694-46286716 AGGAACAGGGCTAGGAGCAGGGG + Intergenic
930034734 2:47078389-47078411 AGGGCAGGGCCTGGGAGCACAGG + Intronic
930109711 2:47668133-47668155 TGGCCAGGGGCTATGAGGAGGGG + Intergenic
930649782 2:53952898-53952920 ACTTCAGTGGCTTGGAGCAGGGG - Intronic
931056256 2:58474709-58474731 CAGTCTGAGGCTAGGAGCAGTGG - Intergenic
932185441 2:69691400-69691422 GTACCAGGGGCTAGGAGCAGTGG - Intronic
932337417 2:70939002-70939024 AGGGCAGGGGCTGGAAGCTGAGG - Intronic
932573133 2:72948706-72948728 AGGGCAGCAGGTAGGAGCAGGGG + Intronic
932721958 2:74145104-74145126 GGGTCAGGGGCTTGGAGGAGGGG - Intronic
933218498 2:79659707-79659729 AGTTTTGGGGCCAGGAGCAGTGG + Intronic
933812523 2:86041814-86041836 AGGGCAGGGGCTAGGAGGCAGGG + Intronic
933954585 2:87354889-87354911 AGGACCGGGGTCAGGAGCAGGGG - Intergenic
934238780 2:90251109-90251131 AGGACCGGGGTCAGGAGCAGGGG - Intergenic
934274416 2:91565601-91565623 AGGACCGGGGTCAGGAGCAGGGG + Intergenic
934461207 2:94214440-94214462 AGGACCGGGGTCAGGAGCAGGGG - Intergenic
934756456 2:96827947-96827969 AGGGAAGGGTCTAGGAGAAGAGG + Intronic
935084819 2:99834940-99834962 AGGTCAGGAGGTCAGAGCAGAGG - Intronic
935162112 2:100538100-100538122 AGGGCAAGGGCAAGGAGAAGAGG + Intergenic
935757461 2:106287613-106287635 AAGTCTGGGGCTGGGCGCAGTGG + Intergenic
936269267 2:111036378-111036400 AAGACAGGGGCCAGAAGCAGGGG - Intronic
936374088 2:111926116-111926138 AAGTCTGGGGCTGGGCGCAGTGG - Intronic
936571893 2:113624623-113624645 AGGTCAGGGGTTAGGGTTAGGGG - Intergenic
936607810 2:113975554-113975576 AGCTCAGAGGTTAGGAGCATAGG - Intergenic
936619050 2:114076127-114076149 AAGTCATGGGCCAGGCGCAGTGG + Intergenic
936792127 2:116163273-116163295 AGGTTATGGGCTAGGGGTAGAGG + Intergenic
937095867 2:119234827-119234849 AGGCCAGGGGCTTGAAGCAGCGG - Intronic
937099746 2:119259660-119259682 AGATCAGGGGCTGGGGACAGTGG + Intronic
937150686 2:119683649-119683671 AGGTCTGTGACTTGGAGCAGAGG - Intronic
937269614 2:120640330-120640352 AAATCAGGGGCCAGGCGCAGTGG - Intergenic
937833307 2:126446296-126446318 AGGTCAGGGGCTCAGGCCAGGGG + Intergenic
938188298 2:129252767-129252789 GGGTCAGGGGTAAGGGGCAGGGG + Intergenic
938308095 2:130268126-130268148 AGAGAAGGGGCTAGGAGCTGGGG + Intergenic
938447236 2:131388710-131388732 AGAGAAGGGGCTAGGAGCTGGGG - Intergenic
939874070 2:147556555-147556577 AGCTCAGGGGCCAAGTGCAGTGG + Intergenic
940012635 2:149071049-149071071 AGGTGAGGGGCTAGGAGGAGAGG + Intronic
941499235 2:166248954-166248976 AGGTCAGAGGCTGGGTGAAGTGG - Intronic
941775195 2:169385842-169385864 AATTCAGGGGCTGGGAGCAGTGG + Intergenic
941966201 2:171303477-171303499 GGGTCATAGGCTAGGCGCAGAGG - Intergenic
942234986 2:173895308-173895330 AGTACAGGGGCTGGGTGCAGTGG - Intergenic
942867011 2:180688936-180688958 AGGTAAGATGGTAGGAGCAGAGG - Intergenic
942920978 2:181373214-181373236 TGGTCAGTGGCTGGAAGCAGAGG - Intergenic
944116518 2:196192632-196192654 AAGCTAGGGGCCAGGAGCAGTGG - Intergenic
944405279 2:199377087-199377109 AACACAGGGGCCAGGAGCAGTGG + Intronic
944702088 2:202254840-202254862 AGCTCAGGGGCCAGGTGCAGTGG - Intergenic
944715172 2:202370633-202370655 AGGGCAGAGGCTGGGAGCAGTGG - Intergenic
945132683 2:206590784-206590806 GTGTCAGGGGATAGGAGCAAGGG + Intronic
945283703 2:208061361-208061383 ATGACAGGGGCTTGGACCAGGGG - Intergenic
946229968 2:218285331-218285353 AGGTTAGGGATTAAGAGCAGGGG - Intronic
946418525 2:219552367-219552389 AGGTCCGGGACTAGGGGCTGGGG + Intronic
947186352 2:227458960-227458982 AGGTCAGGGGGTGGGAACAGAGG - Intergenic
947592828 2:231395249-231395271 TGGTCAGGGGAAAGGTGCAGGGG + Intergenic
947707475 2:232288071-232288093 AAGCCAGGGTGTAGGAGCAGGGG + Intronic
947772048 2:232677993-232678015 ACTTCAGGGGCCAGGAGCAGTGG + Intronic
948047169 2:234952915-234952937 AGGCCCCGGGCTAGGAGCCGCGG - Intronic
948479245 2:238239924-238239946 GCGGCAGGGGCTAGGAGCAGCGG + Exonic
948805547 2:240452306-240452328 AGGTCAGGATATAGGGGCAGGGG + Intronic
1168959201 20:1857216-1857238 AAGTCAGGGGCTGGGAGCACTGG + Intergenic
1169275021 20:4227892-4227914 ACTGCAGGGGCCAGGAGCAGTGG - Intronic
1170583094 20:17713421-17713443 TTGTCAGGGGCTATGAGGAGGGG + Intronic
1171233823 20:23508811-23508833 GGGTCAGGGTGTAGGAGCAGAGG - Intergenic
1171262391 20:23746185-23746207 AAGACAGGGGCTGAGAGCAGAGG - Intergenic
1171456467 20:25275392-25275414 AGGGCAGGGGCTGGCAGGAGAGG + Intronic
1171546846 20:26009074-26009096 TGGTTTGGGGCTGGGAGCAGTGG + Intergenic
1171854641 20:30333365-30333387 AGGGGAGGGGCTTTGAGCAGGGG - Intergenic
1171962128 20:31502514-31502536 TGGTCAGGGGCTGGGTGCGGTGG + Intergenic
1171963363 20:31511757-31511779 AGATCAGAGGCTAGGCGCAGTGG + Intergenic
1171978588 20:31610976-31610998 AGGACAGTGGCTGGGAGCAAAGG + Intergenic
1172025810 20:31947600-31947622 ATGTCACTGGCCAGGAGCAGTGG + Intronic
1172061194 20:32188545-32188567 AGGTCAAGGGCATGAAGCAGTGG - Intergenic
1172248679 20:33463684-33463706 AGGAAAGGGGCCAGGAGCAGTGG + Intergenic
1172447252 20:34999694-34999716 AGGTCAGGGGCTGGCTGCAGGGG + Exonic
1172715095 20:36957222-36957244 AGGTAAGAGATTAGGAGCAGAGG + Intergenic
1172879008 20:38185578-38185600 ATGTAAGGGGCCAGGTGCAGTGG - Intergenic
1173292135 20:41724383-41724405 TGGGCAGGGGCAAGGTGCAGTGG - Intergenic
1173757576 20:45531493-45531515 TGGAAACGGGCTAGGAGCAGTGG - Intergenic
1173887129 20:46469657-46469679 AGCTTAGGGGCCAGGCGCAGTGG - Intergenic
1174240661 20:49132086-49132108 AGCACAGTGGCCAGGAGCAGAGG + Intronic
1174368239 20:50069219-50069241 AGCACAGGGGCTGGGCGCAGTGG - Intergenic
1174421648 20:50403004-50403026 AGGTTAAGGGGCAGGAGCAGTGG + Intergenic
1174493961 20:50925811-50925833 AGGAGAGGGGCTGGGAGCGGTGG + Intronic
1174500248 20:50979034-50979056 AAGAGAGGGGCCAGGAGCAGTGG - Intergenic
1174553974 20:51380987-51381009 AGATCAGGGGGCTGGAGCAGAGG + Intergenic
1174849227 20:53975936-53975958 AGCACAGGGGCCAGCAGCAGGGG + Intronic
1175395933 20:58661710-58661732 AGGTACTGGCCTAGGAGCAGGGG + Intronic
1175598832 20:60256427-60256449 GGGTCAGGGAGTGGGAGCAGTGG + Intergenic
1175868221 20:62192784-62192806 GTGTCAGGAGCCAGGAGCAGGGG + Intronic
1176115251 20:63429319-63429341 ATGGCAGGGCCTGGGAGCAGAGG - Intronic
1176282025 20:64318750-64318772 TGGTCAGAGGCTGGGGGCAGAGG + Intergenic
1176381851 21:6117702-6117724 ACGCCAGGGCCCAGGAGCAGGGG - Intronic
1176457186 21:6924147-6924169 TGGACAGGGGCTGGGCGCAGTGG - Intergenic
1176721907 21:10400468-10400490 AGTTCAGTGGCCAGGCGCAGTGG + Intergenic
1176835359 21:13789231-13789253 TGGACAGGGGCTGGGCGCAGTGG - Intergenic
1177768954 21:25493279-25493301 AAGTCAAGGGCCAGGTGCAGTGG + Intergenic
1177817784 21:25996967-25996989 AGAACAAGGGCTAGGTGCAGTGG - Intronic
1178628090 21:34235031-34235053 TTGTCAGGGGCTGGGAGGAGGGG + Intergenic
1178913138 21:36692672-36692694 AGGGCAGGGGCGAGGGACAGTGG + Intergenic
1178966514 21:37124402-37124424 AGGTCAAGGGCTGGGTGCAGTGG - Intronic
1178997122 21:37412986-37413008 CGGTCAGGGGATAGAACCAGAGG + Intronic
1179441935 21:41400992-41401014 TGTTTAGGGGCTGGGAGCAGTGG - Intronic
1179741621 21:43420537-43420559 ACGCCAGGGCCCAGGAGCAGGGG + Intronic
1179783796 21:43718783-43718805 AGGTCAGGGGCGTGGAGCCCGGG + Intergenic
1179954745 21:44732338-44732360 AGGTGAGGGGAAAGGAGCACTGG + Intergenic
1180015716 21:45081870-45081892 CAGTCAGGGGCTAGGAGGTGAGG + Intronic
1180303097 22:11053245-11053267 AGTTCAGTGGCCAGGCGCAGTGG + Intergenic
1180452073 22:15472727-15472749 CGATCATGGGCCAGGAGCAGAGG + Intergenic
1180959136 22:19754819-19754841 AGGGCAAGGTCAAGGAGCAGTGG + Intergenic
1180959543 22:19756419-19756441 AGGTAAGGGGTGGGGAGCAGAGG - Intergenic
1181166275 22:20984934-20984956 ATGGCAGGGGCCAGGTGCAGTGG + Intronic
1181236216 22:21449035-21449057 ACTTCAGGGACTGGGAGCAGAGG + Exonic
1181456781 22:23064331-23064353 ATGTCAGGGGCTAAGGGCGGAGG + Intronic
1182007139 22:26970315-26970337 AAATCAAGGGCTAGAAGCAGTGG - Intergenic
1182273588 22:29171089-29171111 AGCCCAGGGGCCAGGCGCAGTGG + Intergenic
1182589559 22:31368435-31368457 ATGTCAGAGGCTGGGTGCAGTGG - Intergenic
1182677148 22:32048267-32048289 TGGCCAGGGGCCAGGAACAGAGG + Intronic
1183086046 22:35487880-35487902 AAGTGAGGGGCTGGGTGCAGTGG + Intergenic
1183436418 22:37798157-37798179 AGGACAGGGGCTATGAGAGGGGG + Intergenic
1183983890 22:41558647-41558669 AGGCAAGGGGCTAGGCGCAGTGG + Intergenic
1184067938 22:42130773-42130795 AGGTATGGGGCTAGAAGCACTGG - Exonic
1185005972 22:48277221-48277243 AGGAGAGGGGCTGGCAGCAGGGG - Intergenic
1185257623 22:49844702-49844724 TGTCCAGGGGCTAGGAGAAGTGG - Intergenic
1185280596 22:49968286-49968308 AAGTTGGGGGCAAGGAGCAGAGG + Intergenic
949113694 3:294029-294051 AGGTTACAGGCTGGGAGCAGTGG + Intronic
949402533 3:3680889-3680911 AGCTGTGGGGCTAGGCGCAGTGG + Intergenic
949460241 3:4284126-4284148 AGGTGGGAGGCCAGGAGCAGAGG + Intronic
950150147 3:10680591-10680613 AAGTCAGAGGCTAGGACCCGGGG + Intronic
950574042 3:13820467-13820489 AGGCAAGGGGCTTGGAGCTGAGG + Intronic
951077404 3:18412376-18412398 AGAGCAGGGGCCAGGAGGAGTGG - Intronic
952010241 3:28892478-28892500 AGGTCAGAGGCCAGGCGCAGTGG + Intergenic
952725989 3:36585162-36585184 AAGACAGGGGCCAGGAACAGTGG + Intergenic
952860352 3:37807592-37807614 AGATCTGGGGCTGGGTGCAGTGG + Intronic
953009586 3:39012036-39012058 AATTCTGGGGCCAGGAGCAGTGG + Intergenic
953191946 3:40696155-40696177 AGCTCAGGAGCTTGGAGAAGAGG - Intergenic
953240075 3:41140877-41140899 GGGGCAGGGGCAAGGAGGAGAGG + Intergenic
953329796 3:42043419-42043441 AGGGCAGGGGTCAGGAGGAGGGG - Intronic
953581977 3:44165895-44165917 AGGCCATGGGCTGGGCGCAGTGG + Intergenic
953602699 3:44383683-44383705 GGGTAAGGGGCTGGGTGCAGTGG + Intronic
953727651 3:45414580-45414602 AAGTAAGGGGCTGGGGGCAGTGG + Intronic
953932404 3:47012277-47012299 AGGTCAGGAGCAAGGAACAAAGG - Intergenic
954329752 3:49883514-49883536 AGCTCAGGTGGTAGGAGCTGAGG - Intergenic
954412783 3:50378245-50378267 AAGCCAGGGGCTGGGAGGAGGGG + Intronic
954631759 3:52051636-52051658 AGGTCATGGCCTGGCAGCAGCGG - Intronic
954646560 3:52135240-52135262 AGATCTGTGGCTAGGATCAGAGG - Intronic
955122093 3:56070909-56070931 AGATGAGGGGCTAGGAGTAGTGG - Intronic
955653733 3:61222010-61222032 GGGCCAGGAGCCAGGAGCAGAGG - Intronic
955918771 3:63932704-63932726 GGGTCACGGGAAAGGAGCAGAGG - Intronic
958711514 3:97722497-97722519 AGGTCATGGGCAAGGAGAAGAGG + Intronic
958904581 3:99927830-99927852 GGGGCTGGGGCTAGGAGCAGAGG - Intronic
959393174 3:105802190-105802212 AGGAAAGAGGCTAGGGGCAGGGG - Intronic
959582952 3:108000585-108000607 TTGTCAGGGGCTAGGGGGAGGGG + Intergenic
959856061 3:111160718-111160740 AGTTTAGGGGCTGGGCGCAGTGG + Intronic
960042550 3:113165287-113165309 AGATCTGGGGCTAGGATCTGTGG - Intergenic
960147880 3:114222243-114222265 AGCTTAGGGGCAGGGAGCAGAGG - Intergenic
960387535 3:117038010-117038032 TTGTCAGGGGCCAGGCGCAGTGG - Intronic
960952439 3:123008445-123008467 AGTTCAGGGCCCAGGAGAAGGGG + Intronic
961355954 3:126340165-126340187 AGGCAAGGAGGTAGGAGCAGAGG - Intergenic
961361969 3:126373765-126373787 AGGTCAGGGGCGCTGAGTAGGGG - Intergenic
961561226 3:127731730-127731752 AGGTCAGGGGCCAGAGGGAGAGG - Intronic
961755743 3:129126454-129126476 TGGTCGGGGGCTAGCAGTAGAGG - Intronic
961770910 3:129249455-129249477 GGGGCAAGGGCTAGGTGCAGGGG - Intergenic
962273956 3:133998405-133998427 AGGTCAAGGGGTGGGAGCAGGGG - Intronic
962642687 3:137404263-137404285 AGGTGAAGGGCTAGGGGCACAGG - Intergenic
962748348 3:138414303-138414325 AGGGCAGGGGCTATGGTCAGAGG - Intergenic
963385930 3:144594450-144594472 AGGACATAGGCTAGGGGCAGCGG - Intergenic
963427342 3:145148923-145148945 AGGCCAGGGGCCAGGCGCAGTGG + Intergenic
963601069 3:147379612-147379634 AGGTGAGGGAGGAGGAGCAGAGG + Intergenic
964254637 3:154762259-154762281 ATGTCAGTGGCTGGGCGCAGTGG + Intergenic
965550843 3:169963622-169963644 AGAACAGGGGCCAGGTGCAGTGG + Intergenic
965801507 3:172498523-172498545 AGGTTAGTGGCCAGGAGCAGTGG + Intergenic
966416866 3:179698100-179698122 AGTACAGGGGCTAGGAACATAGG + Intronic
966744103 3:183259311-183259333 AGGGGTGGGGCTAGGAGTAGTGG + Intronic
966755253 3:183364227-183364249 AAGGCAGAGGCCAGGAGCAGGGG + Intronic
967281438 3:187827688-187827710 TGTTCAGGGGCCAGGTGCAGTGG - Intergenic
967395119 3:188999468-188999490 TGCACAGGGGTTAGGAGCAGTGG + Intronic
967638195 3:191830489-191830511 AAGCTAGGGGCTAGGCGCAGTGG + Intergenic
967989359 3:195119918-195119940 AGGTCAGGGGCTGGGCGGGGCGG + Intronic
968225688 3:196970531-196970553 AGGTGAGGGGTTAGCTGCAGAGG - Intergenic
968458431 4:711079-711101 AGGGTGTGGGCTAGGAGCAGAGG - Intronic
968876972 4:3275360-3275382 AAGGCAGGGGCCAGGTGCAGTGG - Intergenic
968897682 4:3414248-3414270 AGGGAAGGGCCCAGGAGCAGCGG + Intronic
970183410 4:13423246-13423268 AGGTGAGAGGCCAGGCGCAGTGG + Intronic
970331658 4:14992607-14992629 AGGCCAGGGGCTGGGAGAACAGG - Intergenic
971138643 4:23899132-23899154 ACCTCAGGGGCTAGGCGCGGTGG - Intronic
971310583 4:25522589-25522611 AAGTCCTGGGCTAGGTGCAGTGG + Intergenic
972532569 4:39974821-39974843 ATGAAAGGGGCTGGGAGCAGTGG + Intronic
973220555 4:47721554-47721576 AGGTTATGGGCTGGGTGCAGTGG - Intronic
974124384 4:57677610-57677632 TTGTCAGGGGCTGGGAGGAGGGG - Intergenic
975473269 4:74794264-74794286 AGGGCAAGGGCCAGGAGCAGTGG + Exonic
975852688 4:78588563-78588585 ACCTCAGGGGCTCAGAGCAGAGG + Intronic
976310750 4:83609931-83609953 TTGTCAGTGGCTAGGTGCAGTGG + Intergenic
976406024 4:84660913-84660935 GGGTCAGGGGGTGGGGGCAGTGG + Intergenic
976636252 4:87288877-87288899 AGTTCATGGGCCAGGTGCAGTGG - Intergenic
976722782 4:88186346-88186368 TGGTTAGGGGCCAGGCGCAGTGG + Intronic
978291770 4:107150518-107150540 AGGGAAGGGGAGAGGAGCAGAGG + Intronic
978428218 4:108604419-108604441 AGCTCAGGGGCCAGGTGCGGTGG - Intergenic
979187933 4:117822413-117822435 AGATCAGGGGCCAGGTGCAGTGG + Intergenic
979704967 4:123710043-123710065 AATTCAGGGGCTGGGCGCAGTGG + Intergenic
980318002 4:131230739-131230761 AAGTAAGGGGCTGGGTGCAGTGG + Intergenic
981576300 4:146209478-146209500 AGGTCATGGGCTCTGGGCAGGGG - Intergenic
981648558 4:147028448-147028470 ATGGCAGGTGCTAGGAACAGAGG - Intergenic
981754261 4:148123949-148123971 TGTTCAGGGGCTGGGTGCAGTGG + Intronic
982224009 4:153149254-153149276 AAGTCAGAGGCCAGGTGCAGTGG - Intergenic
982846054 4:160253852-160253874 AGGGCATGGGCAGGGAGCAGTGG - Intergenic
983249452 4:165327763-165327785 AGGTGAGGGGGTTGGAGGAGTGG + Exonic
983478523 4:168244437-168244459 ATTTCAGGGGCCAGGTGCAGTGG + Intronic
983801804 4:171940532-171940554 AGGTGAAGGGCCAGGCGCAGTGG + Intronic
984457998 4:179995802-179995824 TGGTTATGGGCTGGGAGCAGTGG + Intergenic
986805437 5:11304589-11304611 AGATCAGGGACAAGGAACAGTGG + Intronic
987907126 5:24091380-24091402 AGGGCAGGGTTTAGGAGGAGGGG - Intronic
988855296 5:35222428-35222450 AAGTGTGGGGCTAGGAGCAGTGG + Intronic
988974761 5:36504016-36504038 AGGTCAGGAGCTGGGGGCAGGGG + Intergenic
989546509 5:42680790-42680812 ATGTTTGGGGCTGGGAGCAGTGG - Intronic
990773736 5:59281722-59281744 TTGTCAGGGGCTGGGAGAAGAGG - Intronic
991389579 5:66127915-66127937 AGGTAAAAGGCCAGGAGCAGTGG + Intergenic
991496961 5:67236376-67236398 AGGTGATGGGGTAGGAGCGGAGG + Intergenic
992265047 5:75009956-75009978 TGGTCAGGAGGTAGGAGCAAGGG + Intergenic
992672072 5:79070414-79070436 AGGAAAGGGGCCAGGAGCTGGGG - Intronic
992902397 5:81310985-81311007 AGGCCAGGTGCAAGAAGCAGTGG + Intronic
993010604 5:82478339-82478361 AGGTAAGGGGCTGGGAGAAGAGG + Intergenic
993408734 5:87547765-87547787 AGGACAGGAGCAAAGAGCAGAGG - Intergenic
994417758 5:99496461-99496483 AGCTCAGAGGCTGGGCGCAGTGG - Intergenic
994462206 5:100078700-100078722 AGCTCAGAGGCTGGGCGCAGTGG + Intergenic
994674668 5:102805353-102805375 AGATGAGGGGCCAGGTGCAGTGG - Intronic
994727850 5:103457436-103457458 TGGTCTGGGACTAGGGGCAGAGG - Intergenic
995114507 5:108464279-108464301 TAGTCATGGGCTGGGAGCAGGGG + Intergenic
995286793 5:110398447-110398469 AGGTTTGAGGATAGGAGCAGAGG + Intronic
995859098 5:116623160-116623182 AGGAGAGGGGCATGGAGCAGAGG - Intergenic
996097003 5:119409556-119409578 AGCACAGGGGCCACGAGCAGGGG - Intergenic
996592963 5:125168681-125168703 AGATCTTGGGCCAGGAGCAGTGG + Intergenic
997846101 5:137287283-137287305 AGGTCTGAGTCTAGGAGGAGGGG - Intronic
998393747 5:141804939-141804961 AGGTGAGTGGCTAAGGGCAGGGG + Intergenic
998394472 5:141809845-141809867 AGGCCAGTGGCTAGGAGCCCAGG - Intergenic
998518291 5:142776258-142776280 AAGTGAGTGGCTAGGAGCCGTGG - Intronic
998901230 5:146857122-146857144 TGGTGCAGGGCTAGGAGCAGTGG + Intronic
999174380 5:149621666-149621688 AGGGCAGGGGCTGTGAGAAGGGG - Intronic
999181650 5:149674083-149674105 TTGCCAGGGGCTAGGAGTAGGGG + Intergenic
999727483 5:154448261-154448283 AGGACAGGGGCTGGGCGCAGTGG - Intronic
999800637 5:155030717-155030739 AGGCCATAGGCTGGGAGCAGTGG - Intergenic
999937349 5:156501610-156501632 AAGGCAGAGGCTAGGGGCAGGGG - Intronic
1000761992 5:165237452-165237474 AGGTCAGGAGCAAGGAGCAGTGG + Intergenic
1001198140 5:169692139-169692161 AGGGAAAGGGCCAGGAGCAGTGG - Intronic
1001416425 5:171547637-171547659 AGGCCAGTGGGTAGGGGCAGTGG + Intergenic
1001610484 5:172997520-172997542 AGGTCAGGGGCAAGGCGTGGTGG + Intronic
1002719172 5:181247309-181247331 AGCCCAGGGGCTGGGAGAAGTGG - Intronic
1003031459 6:2604748-2604770 GGGTCTGGGGGTAGAAGCAGGGG + Intergenic
1003238870 6:4323900-4323922 AAGTCAGGGGCTGGGCGCAGTGG + Intergenic
1004177644 6:13354025-13354047 AGGCCAGGGGCTAGATGGAGTGG + Intergenic
1004362251 6:14981547-14981569 AGTTCAGGGCCCAGGCGCAGTGG - Intergenic
1004740194 6:18452689-18452711 AAGGCAGGGGCTAGGAGAGGAGG - Intronic
1005352073 6:24946658-24946680 AGGGCAGGGACTGGGATCAGGGG + Intronic
1005406903 6:25498997-25499019 AGGTCAGGGAGTGGGAGGAGGGG + Intronic
1005656063 6:27938549-27938571 AAAATAGGGGCTAGGAGCAGTGG + Intergenic
1005926829 6:30451717-30451739 GGGTCTGGGGCCAAGAGCAGAGG + Intergenic
1005956047 6:30664194-30664216 AAGGCAGGGGCTAGGCACAGTGG + Intronic
1006179009 6:32142633-32142655 AGGCCAGAGGCCAGGCGCAGTGG + Intergenic
1007094037 6:39202445-39202467 AGGGCAGGGGGCAGGAGCTGGGG + Intronic
1007408718 6:41649347-41649369 AGGGCAGGGGCTCGGAGCCCTGG - Intronic
1007426273 6:41748305-41748327 AGATCAGAGGCCTGGAGCAGGGG + Intronic
1007464815 6:42044279-42044301 TGGTGATGGGCTGGGAGCAGAGG + Intronic
1007724275 6:43905449-43905471 CAGCCAGGGGCTAGGGGCAGAGG - Intergenic
1007763310 6:44146926-44146948 AGGTAAGGGACTGGGGGCAGAGG + Exonic
1007830505 6:44634751-44634773 CGGTCAGGAGCAAGGAGAAGGGG + Intergenic
1007966274 6:46006429-46006451 AAGTTAGGGGCCAGGCGCAGTGG - Intronic
1008068732 6:47077892-47077914 TTGCCAGGGGCTAGGAGGAGAGG - Intergenic
1008463026 6:51798089-51798111 AGGTTGGGGGCCAGGTGCAGTGG + Intronic
1009649087 6:66449658-66449680 ATGTCAGGGGGTGGGAGCAAGGG + Intergenic
1010787755 6:80024581-80024603 TTGCCAGGGGCTGGGAGCAGTGG + Intronic
1013629769 6:111975152-111975174 AGACCAGGGGCCAGGAGCGGTGG - Intergenic
1013892495 6:115042096-115042118 TGCTCAGGGGCTAGGAGTAAAGG + Intergenic
1014112994 6:117641440-117641462 TTGTCAGGGGCTAGAAGGAGGGG - Intergenic
1015025616 6:128529222-128529244 GCATCAGGGGCTGGGAGCAGTGG + Intergenic
1015178782 6:130339332-130339354 AGATTCGGGGCTGGGAGCAGTGG - Intronic
1015537259 6:134279142-134279164 AGGTTACTGGCTGGGAGCAGTGG + Intronic
1016424958 6:143925461-143925483 AAGTAATGGGCTGGGAGCAGTGG - Intronic
1016608804 6:145964590-145964612 AAGGCAGGGGCCAGGAGCGGTGG + Intergenic
1016999928 6:149989611-149989633 TGGACAGGGGCCAGGCGCAGTGG - Intergenic
1017089316 6:150744359-150744381 AGGGCAGGGGCCAGGCGCGGTGG - Intronic
1017132805 6:151122512-151122534 ATGTAAGGGGCCAGGAGCAGTGG + Intergenic
1017820528 6:158045824-158045846 CTGTCAGGGGCCAGGAGCAGTGG + Intronic
1017884319 6:158586658-158586680 AATTCAAGGGCTAGGCGCAGTGG + Intronic
1017899653 6:158708425-158708447 GGGTCAGGGGATAGAAGGAGAGG + Intronic
1017903556 6:158738943-158738965 AGCTGAGGGGCTAGGTGCAGTGG - Intronic
1018014135 6:159696752-159696774 AGGTATGGGGCCAGGTGCAGTGG + Intronic
1018068638 6:160141874-160141896 AGGACAGGAGCTGGGAGGAGGGG - Intronic
1018205416 6:161432667-161432689 AAATCAGAGGCTAGGTGCAGTGG - Intronic
1018667720 6:166154898-166154920 GGATCAGAGGCTAGGATCAGTGG + Intergenic
1018839716 6:167508591-167508613 AGGGAAGGGGCGAGGAGGAGAGG - Intergenic
1019061325 6:169260140-169260162 AGGGCAGGGGATAGGGGGAGGGG - Intergenic
1019267252 7:124756-124778 AGGCGTGGGGCTAAGAGCAGAGG - Intergenic
1019494656 7:1332144-1332166 AGGGGAGGGGCTGGGAGGAGCGG + Intergenic
1019544493 7:1566967-1566989 AGGTCAGGAGAGAGGAGCACGGG - Intergenic
1019697176 7:2452342-2452364 AGGTCAGAAGCTGGAAGCAGCGG + Intergenic
1019892883 7:3960611-3960633 AAGTCCCGGGCCAGGAGCAGTGG - Intronic
1020230451 7:6314412-6314434 CTGCCAGGGGCTAGGAGAAGGGG - Intergenic
1021168428 7:17369135-17369157 TGGCCAGGGGCCAGGAGCAGTGG + Intergenic
1021519016 7:21519871-21519893 AGGTCATGGGGTAGTAGTAGGGG + Intergenic
1021797058 7:24266373-24266395 AAGGCAGGGGCTGGGAGCAGTGG + Intergenic
1022500189 7:30877965-30877987 AGGGAAGGGGCCAGGCGCAGTGG - Intronic
1022514534 7:30966927-30966949 AGGACAGGGGCCGGGCGCAGTGG - Intronic
1022652384 7:32289115-32289137 AGGTCAGAGGCCAGGCACAGTGG + Intronic
1022968381 7:35495211-35495233 TGGCCAGGGGCTGGGGGCAGGGG - Intergenic
1023346607 7:39277769-39277791 AGGTCGGGGGCCAGGAGCGGTGG + Intronic
1023918769 7:44610587-44610609 ATGAAAAGGGCTAGGAGCAGTGG - Intronic
1023966692 7:44966600-44966622 AGTCCAAGGGGTAGGAGCAGAGG - Intronic
1025249174 7:57340472-57340494 AGGTTAAGGGCCAGGAGCAGTGG - Intergenic
1025285136 7:57654489-57654511 AGGACTGGGGCTCGGTGCAGGGG - Intergenic
1025934430 7:66023431-66023453 TTGCCAGGGGCTAGGAGGAGGGG + Intergenic
1026378322 7:69774123-69774145 ATGTCCAGGGCTGGGAGCAGTGG + Intronic
1026567394 7:71500848-71500870 AGGACAGGGGTTTGGAGGAGTGG - Intronic
1026568573 7:71510232-71510254 ATTTCAGGGGCCAGGTGCAGTGG - Intronic
1026830973 7:73609962-73609984 TGGTCAGGGGCTGGGAGCGGTGG - Intronic
1026989581 7:74576271-74576293 GTGTCAGGGGCCAGGTGCAGTGG + Intronic
1027218841 7:76201692-76201714 AGGTGAGGGGCGAGGGGAAGGGG + Intergenic
1027660558 7:80983258-80983280 AAGACAAGGGCTAGGTGCAGTGG - Intergenic
1027995718 7:85423600-85423622 AGAGCAGGTGCTGGGAGCAGAGG - Intergenic
1028446654 7:90932215-90932237 TGGTCTGCGGCTGGGAGCAGTGG + Intronic
1028959478 7:96732722-96732744 AGGTAGGGGGCTGGGTGCAGTGG - Intergenic
1029246467 7:99205560-99205582 AGATGGGGGGCTGGGAGCAGTGG + Intronic
1030669019 7:112314503-112314525 AGGTTAGAGGCCAGGCGCAGAGG + Intronic
1031593432 7:123620847-123620869 AGGTCACGGGCCAGGCACAGTGG - Intronic
1031813694 7:126405644-126405666 AGGTCAGGGGCGAAGATCACGGG + Intergenic
1031950643 7:127888389-127888411 ACGGGAGGGGCTAGGAGTAGAGG - Intronic
1032070843 7:128805807-128805829 AGGTCAGTGAGGAGGAGCAGAGG + Exonic
1032081432 7:128860425-128860447 AGGTCAGGGATTAGGAGTTGGGG - Intergenic
1032339076 7:131054302-131054324 AGCTCAGGTGCTGGGAACAGTGG - Intergenic
1032872496 7:136001388-136001410 AAGCCAGGGGCCAGGTGCAGTGG + Intergenic
1033086672 7:138348815-138348837 AAGGCAGGGGCCAGGCGCAGTGG - Intergenic
1033221546 7:139529777-139529799 AGTAAAGGGGCCAGGAGCAGTGG + Intronic
1033436095 7:141334935-141334957 AGGGCAGGTCCTAGGAGAAGTGG + Intronic
1034044238 7:147911121-147911143 TGGCCAGGGGCTAGGAGGAGAGG - Intronic
1034840564 7:154391649-154391671 TGGTGAGAGGCTAGAAGCAGGGG - Intronic
1034849578 7:154481119-154481141 AGCTCAGGTGCAAGGAGAAGGGG + Intronic
1035795706 8:2354730-2354752 AGGTCGGGAGCTGGCAGCAGAGG - Intergenic
1036935569 8:12999011-12999033 TGTTCAGGGGCTGGGCGCAGTGG + Intronic
1037750720 8:21680413-21680435 AGGTCAGGGGTCAGAAGCAAAGG - Intergenic
1038194631 8:25355735-25355757 AGGTTAGAGGCTGGGTGCAGTGG - Intronic
1038442889 8:27584138-27584160 AAGTGAGGGGCGAGGATCAGAGG - Intergenic
1038634644 8:29275876-29275898 AGGCCTGAGCCTAGGAGCAGAGG + Intergenic
1038730285 8:30120979-30121001 CTGCCAGGGGCTGGGAGCAGGGG - Intronic
1038774115 8:30512724-30512746 TGGTCAGTGGCCAGGTGCAGTGG - Intronic
1038890159 8:31712553-31712575 AGATCATGGGCTGGGCGCAGTGG - Intronic
1038965807 8:32570194-32570216 ATATCAGAGGCCAGGAGCAGTGG - Intronic
1039477083 8:37844741-37844763 GGGACAGGGGCAAGGAGAAGGGG - Exonic
1039592456 8:38760807-38760829 AGGTCTGAGGCCAGGCGCAGTGG - Intronic
1039847489 8:41336084-41336106 AGGCTAGGGGCTGGGAGCAATGG + Intergenic
1040361916 8:46673775-46673797 AGGTAGGTGGCTAGGAGCAGTGG - Intergenic
1040554769 8:48468960-48468982 ATGACTGGGGCTAGGAGCAGAGG - Intergenic
1041932532 8:63302697-63302719 AGGGCAGGTGCTAGGAGCTAAGG + Intergenic
1042249064 8:66737901-66737923 AGGTCCGGGGCTGGGTGCGGTGG - Intronic
1042317858 8:67443345-67443367 AGGACAGGGCCCGGGAGCAGTGG - Intronic
1042610818 8:70598977-70598999 AACTCAGGGGCTAGATGCAGTGG + Intronic
1043432687 8:80210232-80210254 TGTCCAGGGGCCAGGAGCAGTGG + Intronic
1045503325 8:102759753-102759775 AAGTTGGAGGCTAGGAGCAGTGG - Intergenic
1045517975 8:102877590-102877612 AGGGCAGGAGCAAGCAGCAGTGG - Intronic
1046368987 8:113275710-113275732 AGGTAAGAGACCAGGAGCAGTGG + Intronic
1046380547 8:113444291-113444313 AGGGGAGGGGGTGGGAGCAGAGG - Intergenic
1048392967 8:133985653-133985675 ATGGCAGGGGCCGGGAGCAGTGG + Intergenic
1048991962 8:139765703-139765725 AGGTGAGGGTCTGGGGGCAGAGG + Intronic
1049587602 8:143439223-143439245 ACGTCAGGGGCGTGGAGCCGTGG - Intronic
1049599194 8:143499176-143499198 AGGGAAGGGCCTGGGAGCAGAGG + Intronic
1049894277 9:99174-99196 TTGTCAGGGGCTGGGAGAAGAGG + Intergenic
1050321621 9:4458500-4458522 TGGCCAGGGGCCAGGTGCAGTGG + Intergenic
1050505835 9:6348258-6348280 AGGTCATAGGCTGGGTGCAGTGG + Intergenic
1050573989 9:6973330-6973352 TGGTCAGGGGCTGGGTGCAGTGG - Intronic
1050781249 9:9339188-9339210 AGGTGAGAGGCTAGGCGCGGTGG + Intronic
1051353522 9:16220328-16220350 AGGGCAGGGGCTGGGTGCAGTGG - Intronic
1052197492 9:25735116-25735138 AGGGCAGGGTCTAGGATCAGAGG - Intergenic
1052303097 9:26975156-26975178 GGGTCAGGGGCACTGAGCAGAGG + Intronic
1053321919 9:37106322-37106344 AGGTTAGAGGCTGGGCGCAGTGG - Intergenic
1053735505 9:41099279-41099301 TTGTCAGGGGCTGGGAGAAGAGG + Intergenic
1053792462 9:41696645-41696667 AGGGGAGGGGCTTTGAGCAGGGG - Intergenic
1054152710 9:61618175-61618197 AGGGGAGGGGCTTTGAGCAGGGG + Intergenic
1054180872 9:61908665-61908687 AGGGGAGGGGCTTTGAGCAGGGG - Intergenic
1054656719 9:67672477-67672499 AGGGGAGGGGCTTTGAGCAGGGG + Intergenic
1054692872 9:68332122-68332144 TTGTCAGGGGCTGGGAGAAGAGG - Intronic
1055944235 9:81678524-81678546 AATTTAGGGGCTGGGAGCAGTGG + Intronic
1056060162 9:82877248-82877270 AGGACAGGAGCTAGAAGTAGTGG + Intergenic
1056723709 9:89093674-89093696 AGGACAGGGGCTTGGGGGAGGGG + Intronic
1056957853 9:91096786-91096808 AGGTCAAGGGGTGAGAGCAGAGG - Intergenic
1057056590 9:91966269-91966291 AGGGAAGGTCCTAGGAGCAGAGG - Intergenic
1057080912 9:92173900-92173922 AGGTCACAGCCTAGGAGCATAGG - Intergenic
1057124443 9:92605274-92605296 ATGTAAGGGGCTGGGCGCAGTGG - Intronic
1057522620 9:95772138-95772160 AGGGGAGGGGCTGGGAGGAGGGG + Intergenic
1057700786 9:97361934-97361956 AGGTCCAGGGCCAGGGGCAGGGG - Intronic
1057955574 9:99404694-99404716 AGGTAAGGGGCCAGGCGCGGTGG - Intergenic
1059214995 9:112553141-112553163 AGGGCAGGGGAGGGGAGCAGAGG - Intronic
1059226907 9:112680888-112680910 AGGTCAGCAGGTAGGTGCAGGGG + Intergenic
1059392546 9:114008239-114008261 GGGATAGGGGCTGGGAGCAGTGG + Intronic
1060510997 9:124232471-124232493 AAGTCACGGGCCAGGTGCAGTGG + Intergenic
1060621624 9:125072695-125072717 CTGCCAGGGGCTAGGAGGAGGGG - Intronic
1060815429 9:126632689-126632711 AGGCCTGGGGCTTGGAGCTGGGG + Intronic
1060970924 9:127737364-127737386 AGGGCAGGGGATAGGAGCACTGG + Intergenic
1061231320 9:129317542-129317564 AGGTCAGAGGCCAGGTACAGTGG + Intergenic
1061310235 9:129757274-129757296 AGGTCAGGAACCAGCAGCAGAGG - Intergenic
1061518246 9:131102198-131102220 ACATCAGGGGCCAGGTGCAGTGG - Intronic
1061603948 9:131694215-131694237 AGGGCAAGGGCTGGGGGCAGAGG + Intronic
1061794871 9:133080618-133080640 AGGTTAGGGGCTGGGCGCAGTGG + Intronic
1061950415 9:133932882-133932904 GTGGCAGGGGCCAGGAGCAGAGG + Intronic
1062028447 9:134351210-134351232 AGGTCTGGGGCTAGGAGGCCCGG + Intronic
1062152961 9:135031290-135031312 AGATGGGGGGCTAGAAGCAGGGG + Intergenic
1062174454 9:135153259-135153281 AGGTCAGAGGCCAGCAGGAGGGG - Intergenic
1185829614 X:3287944-3287966 AGTACAGGGGCTGGGAACAGTGG + Intergenic
1187923142 X:24225257-24225279 ATGTCAGAGGCTAGGAGGATGGG - Intergenic
1187926847 X:24258401-24258423 AGTTCACGGGCTAGGCGCGGTGG + Intergenic
1187961695 X:24572026-24572048 AGGGGAGGGGAAAGGAGCAGCGG + Intronic
1189055725 X:37697826-37697848 CTGCCAGGGGCTAGGGGCAGGGG - Intronic
1189840498 X:45070856-45070878 AGGTCAGGGGCAATGGGCAGTGG + Intronic
1189907527 X:45776886-45776908 AGGTCAGGGGCAGGGGGCAGGGG + Intergenic
1190020373 X:46868806-46868828 ATGTCAGTGGCCAGGCGCAGTGG + Intronic
1190726876 X:53195639-53195661 AGGGCAGGGGCATGGAGGAGAGG - Intronic
1190802486 X:53804376-53804398 AAGTTAAGGGCTGGGAGCAGTGG + Intergenic
1190864974 X:54376777-54376799 AGGTCTGGGGCCGGGCGCAGTGG + Intergenic
1191954301 X:66626816-66626838 AGGACAGGGGACAGGAGGAGAGG + Intronic
1192036258 X:67565978-67566000 TGGTCTGGGGCTGGGAGCAGTGG - Intronic
1192222232 X:69205147-69205169 ATTTCAGGGGCTGGGCGCAGTGG - Intergenic
1192243048 X:69349863-69349885 AGGTCAGGGTGCAGGAGAAGGGG - Intergenic
1192360381 X:70435155-70435177 AGGCTAGGGGCTAGGAGAAAGGG - Intergenic
1194527755 X:94998874-94998896 AGATTAGGGGCTGGGTGCAGTGG - Intergenic
1194719407 X:97323191-97323213 AGCTCAGGGGCTGGGTGCGGTGG - Intronic
1194749991 X:97673455-97673477 CGGACATGGGGTAGGAGCAGGGG - Intergenic
1195755593 X:108195950-108195972 AGGTCTTGAGCTAGAAGCAGTGG - Intronic
1196254759 X:113503932-113503954 AGGTAAGGGGATAGGAGGAATGG + Intergenic
1196707951 X:118732213-118732235 TTGCCAGGGGCTAGGGGCAGGGG - Intronic
1196734436 X:118972307-118972329 AGCTCAGGGGCCAGGCGCGGTGG + Intergenic
1197027098 X:121765984-121766006 AATTCTGGGGCTGGGAGCAGTGG + Intergenic
1197451223 X:126621034-126621056 AGCTCAGGGGCCAGAGGCAGTGG + Intergenic
1197483679 X:127019974-127019996 AGGTCAGAGGCCAGGCGCAGTGG + Intergenic
1198224279 X:134631249-134631271 AGGTCAGGGGCAAGGCCAAGAGG - Intronic
1198612415 X:138416805-138416827 AAGTCAAGGGCTGGGTGCAGTGG - Intergenic
1199411670 X:147530704-147530726 AGGTAAGAGACTAGAAGCAGAGG + Intergenic
1199805146 X:151292035-151292057 ATATAAGGGGCTAGGTGCAGTGG - Intergenic
1200015302 X:153157845-153157867 TTGCCAGGGGCTAGGAGGAGGGG + Intergenic
1200043204 X:153384742-153384764 AGGGCTGGGGCTGGGAGGAGTGG + Intergenic
1200075749 X:153549766-153549788 AGGGCCGGGGGCAGGAGCAGGGG + Intronic