ID: 1090376705

View in Genome Browser
Species Human (GRCh38)
Location 11:126294681-126294703
Sequence GGGGGCACAAAAGTACACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090376705 Original CRISPR GGGGGCACAAAAGTACACAT TGG (reversed) Intronic
905106956 1:35569388-35569410 TGGGAAACACAAGTACACATAGG - Intergenic
905542007 1:38767277-38767299 GGGGAGACAAAAGGACAGATTGG + Intergenic
906431621 1:45760163-45760185 GGGGCCACAACTGTACACTTGGG - Intergenic
907919742 1:58901500-58901522 GGGTTCAACAAAGTACACATAGG - Intergenic
910559582 1:88576195-88576217 GGAGGCAAGAAAGTACATATGGG + Intergenic
921607246 1:217170199-217170221 GGTGGCACAAAACTATAGATGGG - Intergenic
921851359 1:219935255-219935277 GATGGCACCAAAGAACACATAGG - Intronic
923675722 1:236079450-236079472 GGGTGCACAAAGCGACACATGGG + Intergenic
1063144066 10:3280491-3280513 AGAGGCACAGAAGTCCACATTGG - Intergenic
1064642652 10:17430017-17430039 GGGATCAAAAAACTACACATAGG - Intronic
1065086919 10:22187659-22187681 GGGGGCACAACAGACCACACAGG - Intergenic
1067050054 10:43010594-43010616 GGGCCCACCAAAGCACACATGGG - Intergenic
1071057786 10:81530964-81530986 AGGGGCACAAAATGACAGATAGG - Intergenic
1075352886 10:121741258-121741280 TGGGGCTCAAAAGGACAAATAGG + Exonic
1076919369 10:133443415-133443437 AGGGACACACAAGCACACATAGG + Intergenic
1079778149 11:24560562-24560584 AGGTGCACTAAAGAACACATAGG + Intronic
1083818426 11:65151163-65151185 TGGGGCACTAAGGTACAGATTGG + Intergenic
1086506453 11:87509374-87509396 GGGGGCATAAAAGTTTACATGGG + Intergenic
1090376705 11:126294681-126294703 GGGGGCACAAAAGTACACATTGG - Intronic
1092294467 12:7187313-7187335 TGGAGCACAAAAGCAGACATAGG - Intergenic
1093044783 12:14430446-14430468 GAGAGCACAAAAATTCACATAGG + Intronic
1093590591 12:20897139-20897161 GAGGGCACAAAACTACACTGAGG - Intronic
1093738900 12:22658182-22658204 GGGGACAGAGAAGTTCACATGGG + Intronic
1096018720 12:48303973-48303995 GAGGGCAAAAAAGAACAAATGGG + Intergenic
1098242568 12:68483356-68483378 AATGGCAAAAAAGTACACATAGG - Intergenic
1100020111 12:90058518-90058540 GGTCGCACAAAAATACATATTGG + Intergenic
1104483742 12:129131010-129131032 GGGGGCACAGAAAAACACCTTGG - Intronic
1109215828 13:59588867-59588889 GAGGGAACAAAAGAACACTTAGG - Intergenic
1110902206 13:80837391-80837413 GGTGGCACTAAAGTACAGCTTGG - Intergenic
1111007225 13:82263420-82263442 GAGGTCATAAAAGCACACATTGG - Intergenic
1112102937 13:96210113-96210135 GATAGCAAAAAAGTACACATAGG - Intronic
1113534433 13:111053215-111053237 AGGGACACAAGACTACACATTGG - Intergenic
1117230535 14:53712880-53712902 GGGGGCAAAAGACTACAAATTGG - Intergenic
1117607241 14:57442223-57442245 GGGGGCACCAGAGTACACAAAGG - Intergenic
1122651088 14:103227427-103227449 GAGGAAACAAAACTACACATAGG + Intergenic
1128890143 15:71324427-71324449 GGAAGAAAAAAAGTACACATTGG - Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1137673129 16:50291035-50291057 GGGGGCAGAGAAGTTCACAGCGG + Intronic
1137875267 16:51990679-51990701 AGGGACACTAAACTACACATTGG - Intergenic
1142613335 17:1121179-1121201 GGGGACACAAAAGAAGACAAAGG + Intronic
1146652519 17:34615307-34615329 GGGGGTACTAAACTACAGATTGG - Intronic
1146687102 17:34848618-34848640 GGTAGCACAAAAGCACACAAAGG + Intergenic
1146990821 17:37270400-37270422 AGGGGCACAAAAATACAGAAAGG + Intronic
1150974357 17:70066971-70066993 GATGGCAGAAAAGAACACATGGG + Intronic
1155548198 18:26937153-26937175 GAGGGGAAAAAAGTATACATTGG - Intronic
1155715908 18:28943431-28943453 GAGGGCACATAACTGCACATAGG - Intergenic
1157505013 18:48219939-48219961 GGGGCCATAACAGGACACATGGG - Intronic
1158376334 18:56873559-56873581 GGGGGCACAGAAGCACATATGGG - Intronic
1159090589 18:63844261-63844283 GGGGGAACAGAGATACACATAGG - Intergenic
1164526117 19:29014853-29014875 GGGGGCACCGAAGCCCACATAGG - Intergenic
1167203145 19:48081453-48081475 GGGGATAAAAAACTACACATTGG + Intronic
925028572 2:629078-629100 GGGGGCACCGAAGTTCACACGGG + Intergenic
927199901 2:20571683-20571705 AGGGGCACAGAAGTACCCATGGG - Intronic
928825756 2:35419604-35419626 GAGGGCACAACAGTAAACTTTGG + Intergenic
928988967 2:37210638-37210660 TGGGGGATAAGAGTACACATTGG + Intronic
930204315 2:48572955-48572977 GAGGGCACAAAAACACACAGCGG - Intronic
930745914 2:54883438-54883460 GGGAGAACAAAATTACACACAGG + Intronic
932125020 2:69137420-69137442 GGTGGCATAAATGGACACATTGG - Intronic
940298349 2:152152890-152152912 GGGGGCTCAAAAGAAGACAGGGG + Intronic
944417927 2:199497332-199497354 GGGGGAAAAAAAATACACATTGG + Intergenic
946338887 2:219056060-219056082 GGGGTCACAGAAGATCACATTGG - Intronic
946929703 2:224659667-224659689 GTGGGCAGAGAAGGACACATAGG - Intergenic
947912867 2:233812961-233812983 AGGGGCACAATAGAACTCATGGG + Intronic
948044899 2:234936130-234936152 AGGGACAAAAGAGTACACATCGG - Intergenic
1174717959 20:52780449-52780471 GGGGGTTGACAAGTACACATTGG - Intergenic
1175086091 20:56460444-56460466 GGAGTGACAAAAGTAAACATCGG - Intergenic
1178371895 21:32033313-32033335 GAGGGCCCAGAAGAACACATTGG - Intronic
1181011113 22:20041085-20041107 GGGGGCACACATGTGCACACAGG + Intronic
1181829004 22:25544129-25544151 GGGGGAACAAAAGGACACTGTGG + Intergenic
1183420768 22:37710141-37710163 GGGGGCACATGTGTGCACATAGG - Intronic
1184916726 22:47574576-47574598 GGGGGCCCAGAAGGACACAGTGG - Intergenic
1185334524 22:50265663-50265685 GGGGGCACACAAGAACACCTGGG + Intronic
949991149 3:9580312-9580334 GGAGGCAGAAAAGTTCACTTTGG - Intergenic
950374103 3:12556428-12556450 GGGGGCAGAAGAGGACGCATTGG + Intronic
952927314 3:38329471-38329493 GGGGCTACAGAAGCACACATAGG + Intergenic
954474085 3:50727063-50727085 GGAGGCACAGAAGAACAAATGGG + Intronic
954535325 3:51355422-51355444 GGGACAACAATAGTACACATGGG - Intronic
957913007 3:86647151-86647173 GGGGGAACAAAACTAAAAATGGG + Intergenic
958168326 3:89906009-89906031 GAGGGCAAGAAAGTGCACATGGG + Intergenic
958902362 3:99903051-99903073 AGGGACACAAAAGTATAAATGGG - Intronic
959764202 3:110005091-110005113 GGGGGAACAAAAGTACACAAAGG - Intergenic
964396257 3:156249260-156249282 GGGGGAACAAGAGTAAACACAGG + Intronic
965471669 3:169100456-169100478 GGGGGAAAAAAAGTACATATGGG + Intronic
977622776 4:99155866-99155888 GAGGGAAAAAAAGTTCACATTGG + Intronic
981372319 4:143973010-143973032 AGGGACAAAAAACTACACATTGG - Intergenic
985806201 5:2045202-2045224 TGGGGAACAAAAGAAAACATTGG + Intergenic
990770463 5:59238238-59238260 GGGGGCACAAAACTAATAATAGG + Intronic
991185051 5:63796528-63796550 GGGGGCAAGACAGAACACATAGG - Intergenic
995562863 5:113401991-113402013 GGGGGCACAAAAACACACTCAGG + Intronic
1004505616 6:16244509-16244531 AGGGGCTCAAAAGTGCAAATGGG - Intronic
1009962669 6:70542656-70542678 GGGGACATAAAAGTATATATGGG - Intronic
1010708365 6:79141583-79141605 GAGAGCACAAAAGTAAAAATCGG + Intergenic
1012538764 6:100334321-100334343 GTGGGCACAAATATAAACATGGG - Intergenic
1015758993 6:136637146-136637168 AGGGGCTAAAAAGTAAACATTGG - Intronic
1016330456 6:142947342-142947364 GGGTGCACACCAGTCCACATAGG - Intergenic
1017823848 6:158067660-158067682 TGGGGCATGAATGTACACATGGG - Intronic
1018042709 6:159939343-159939365 GGGGGCAGAAAGGTATACAAAGG + Intergenic
1019108061 6:169684936-169684958 GGGGGTACACATGTACACATAGG - Intronic
1020581209 7:10004601-10004623 TGTGGCCCAAAAGTAGACATAGG + Intergenic
1023136704 7:37059884-37059906 GCAGGCACAGAACTACACATGGG + Intronic
1032622472 7:133550227-133550249 GGGGTCACATTAGTACACAAAGG - Intronic
1035928254 8:3752805-3752827 GGGTGCTGAGAAGTACACATCGG - Intronic
1043038037 8:75222930-75222952 GGGGAAACAAAAGAACAAATCGG + Intergenic
1043790308 8:84458333-84458355 GAGGGCATAAAAGTACAATTCGG + Intronic
1047525561 8:125631124-125631146 GGGGGTACAAAATTACAGACAGG + Intergenic
1047966256 8:130048997-130049019 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966294 8:130049144-130049166 GGGGGCAGATGAGAACACATGGG + Intergenic
1047966316 8:130049207-130049229 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966337 8:130049269-130049291 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966358 8:130049331-130049353 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966363 8:130049351-130049373 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966385 8:130049414-130049436 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966398 8:130049455-130049477 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966425 8:130049538-130049560 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966460 8:130049642-130049664 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966492 8:130049745-130049767 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966513 8:130049807-130049829 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966526 8:130049848-130049870 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966553 8:130049931-130049953 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966566 8:130049972-130049994 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966605 8:130050097-130050119 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966626 8:130050159-130050181 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966639 8:130050200-130050222 GGGGGCAGAGGAGAACACATGGG + Intergenic
1047966645 8:130050221-130050243 GGGGGCAGAGGAGAACACATGGG + Intergenic
1048779991 8:137990027-137990049 GGTGGTACCAAAGTACACCTGGG + Intergenic
1054950893 9:70850262-70850284 TGTGGCACAAAAGTACACATTGG - Intronic
1055807687 9:80115257-80115279 GGAGGCACAAAAGTTCTTATCGG - Intergenic
1057715858 9:97495009-97495031 TGGGACAAGAAAGTACACATTGG - Intronic
1060124651 9:121031559-121031581 TGGGGAACACAAGTACACAGAGG + Intronic
1193119376 X:77807474-77807496 GGGGGTAAAAGACTACACATTGG - Intergenic
1194018797 X:88660464-88660486 GGGCTCAGAAAATTACACATAGG - Intergenic
1194636948 X:96357422-96357444 GGGAGCACAAATGTACTCTTTGG - Intergenic
1195421405 X:104679148-104679170 GAAGGGACAAAAGTACACAACGG - Intronic
1197283984 X:124573382-124573404 GGGATCACAAAAGTATACATAGG + Intronic
1197467356 X:126821062-126821084 GGGGGCACAAAGGTCAACAATGG + Exonic
1199059436 X:143336948-143336970 GGGGGAACAAAATTAAATATTGG - Intergenic