ID: 1090377166

View in Genome Browser
Species Human (GRCh38)
Location 11:126298948-126298970
Sequence CCGTTGTTCCAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090377166_1090377172 21 Left 1090377166 11:126298948-126298970 CCTTCTTCCCTCTGGAACAACGG 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1090377172 11:126298992-126299014 ATCACCTTCTCTCCTTTAGTAGG 0: 1
1: 0
2: 0
3: 12
4: 176
1090377166_1090377173 22 Left 1090377166 11:126298948-126298970 CCTTCTTCCCTCTGGAACAACGG 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1090377173 11:126298993-126299015 TCACCTTCTCTCCTTTAGTAGGG 0: 1
1: 0
2: 3
3: 18
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090377166 Original CRISPR CCGTTGTTCCAGAGGGAAGA AGG (reversed) Intronic
900682361 1:3924026-3924048 CCTGTGTCCCAGAGGGGAGATGG + Intergenic
902114008 1:14106413-14106435 GGGTTGTTCCACAGGGAATACGG - Intergenic
902540154 1:17149000-17149022 CCTTTATTCCAGAGGGGACAAGG + Intergenic
903583316 1:24388642-24388664 CCGTTGCTCCAGATCGAACATGG - Intronic
906050705 1:42869001-42869023 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
908632212 1:66121572-66121594 CTGTTGTTCCAAAAGGAAAATGG + Intronic
908671238 1:66549946-66549968 CTGTTGTTCCAGAAGGAAGCAGG + Intronic
908825921 1:68132497-68132519 CCCTTGTTTCATAGGAAAGATGG - Intronic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
924265468 1:242277190-242277212 CCTTTGCTCCAGGGGAAAGAGGG + Intronic
1064031813 10:11887522-11887544 CCGTTGTTCAGGAAGCAAGAGGG - Intergenic
1066719359 10:38321286-38321308 CCTTTGCTCCAGGGGAAAGAGGG - Intergenic
1067131846 10:43572584-43572606 CCTTTGTTTCAGAGAGCAGAAGG - Intronic
1068420935 10:56792175-56792197 CTGTTGTTTTAGAGGGGAGATGG - Intergenic
1069380360 10:67838030-67838052 CTCTTGTTTCCGAGGGAAGAAGG - Exonic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1070510776 10:77158675-77158697 CCTTTGTTTCATAGGGAGGAAGG + Intronic
1071737453 10:88317958-88317980 CCCGTGATCCAGAGGGCAGAGGG - Intronic
1072001232 10:91197651-91197673 CCTTGCTTCCAGAGGGAAAATGG + Intronic
1073995660 10:109313196-109313218 TCTTAGTTCCAGAGGGAAGAAGG - Intergenic
1075727348 10:124617341-124617363 ACGTTGTGCCAGACGGAGGACGG + Exonic
1082999870 11:59281430-59281452 ACTTAGTTCCAGAGGGAGGAAGG + Intergenic
1086312594 11:85550886-85550908 CCGTATTTCCAAAGGAAAGAAGG + Intronic
1088088401 11:106008294-106008316 GCTTTGTTCCTCAGGGAAGAGGG + Exonic
1089997549 11:122923186-122923208 GTGTTATTCCAGAGGGCAGAGGG + Intronic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG + Intergenic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092863352 12:12738821-12738843 CCTTTGTTCCTGAGGATAGAAGG + Intronic
1093824392 12:23665511-23665533 CCGTTGATCAGGAGGGAATACGG + Exonic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101952393 12:109186999-109187021 CCGTTCTCCCAGAGGGAATCAGG + Intronic
1103288403 12:119823103-119823125 CCTTTGGTCCAAAGGGAAGAGGG - Intronic
1104140141 12:125979758-125979780 TCTTTGTTTCAAAGGGAAGAAGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1107020167 13:35743138-35743160 GCCTTATTTCAGAGGGAAGAGGG + Intergenic
1109335709 13:60991050-60991072 CCTTTGGTCCACAGGGGAGAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112867655 13:103926279-103926301 ACATTGTTCACGAGGGAAGATGG - Intergenic
1114484958 14:23056913-23056935 CCTTTGCTCCCGAGGGAAGGGGG + Intronic
1116104008 14:40476316-40476338 CCGTTGGTCCAGAGAGAACATGG - Intergenic
1118876265 14:69787399-69787421 CTTTTATTCCAGTGGGAAGATGG + Intronic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123708018 15:22964614-22964636 CCTTTTTCCCAGAGGGAACATGG - Intronic
1124637928 15:31376766-31376788 CCGGTGTCCATGAGGGAAGAGGG + Exonic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1138514647 16:57529281-57529303 CCGGTGGCCCAGAGGGAAGCGGG - Exonic
1139154570 16:64424920-64424942 CAATTGTACCAGAAGGAAGAGGG - Intergenic
1140656259 16:77143265-77143287 CTTTTGTTCCACAGGGGAGAAGG - Intergenic
1140872886 16:79122997-79123019 ACATTGTTCAAGAGAGAAGAAGG - Intronic
1142464390 17:121432-121454 CCCTTGTACCACTGGGAAGAAGG - Intergenic
1143001218 17:3796459-3796481 CCCATGTCCCAGAGGGGAGACGG - Intronic
1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG + Intronic
1155626616 18:27842582-27842604 CCTTTATTGCAGAGGTAAGATGG - Intergenic
1156039436 18:32803849-32803871 CCGTTGTTCCAGCAGAAGGAAGG + Intergenic
1156410993 18:36828534-36828556 CCGTTGTTACAGAGGAAAGTGGG - Intronic
1156569205 18:38233500-38233522 CGGGTGGTCCAGAGAGAAGATGG + Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158684519 18:59600938-59600960 CCTTGCTTTCAGAGGGAAGAAGG + Intronic
1160536777 18:79598703-79598725 ACTTTGTTCCAGAGAGAAAAGGG + Intergenic
1160722338 19:603139-603161 CCCTCGTCCCACAGGGAAGAGGG + Intronic
1160722426 19:603375-603397 CCCTCGTCCCACAGGGAAGAGGG + Intronic
1161769145 19:6222047-6222069 CCGCTGTTCCAGAAGGGAGGCGG + Intronic
1164378552 19:27711352-27711374 CTGTTGTTCAAGTGTGAAGAAGG + Intergenic
1164702884 19:30298220-30298242 CCGCTATTCTAAAGGGAAGAGGG - Intronic
1165604651 19:37091328-37091350 CCTTTGTTCATCAGGGAAGATGG - Intronic
1166751399 19:45165448-45165470 CCATTGTTCCTGAGGGAAGGGGG - Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
936025211 2:109026501-109026523 CCCTTGCTTCAGAGGGAAGAGGG - Intergenic
936154551 2:110039717-110039739 CCCCTGTTTCAGAGAGAAGAGGG + Intergenic
936190132 2:110331697-110331719 CCCCTGTTTCAGAGAGAAGAGGG - Intergenic
938250569 2:129812791-129812813 CCATTGTCCCAGTGGGAAGGCGG + Intergenic
941725638 2:168857358-168857380 ACGTGGTTGCAGAGGGAATAGGG + Intronic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
1169016805 20:2298923-2298945 CCGCTGTCCCAGGTGGAAGAAGG - Intronic
1172239241 20:33401319-33401341 ACGGTGTTCAAGAGGGAGGATGG - Intronic
1173269256 20:41517027-41517049 CGGGTGTTCAAGAGGGAAGCAGG - Intronic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
950301774 3:11885781-11885803 CAGTAGTTCCACAGTGAAGAAGG - Intergenic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
966294398 3:178402177-178402199 CCTTTGTTCCCTATGGAAGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969686307 4:8676285-8676307 CTGTTGTTCCACAGAGAAGGAGG - Intergenic
970345381 4:15147801-15147823 CTTTTGTGCCAGATGGAAGAAGG - Intergenic
972205765 4:36770795-36770817 CTTTTGTTCCAGAGAGGAGATGG - Intergenic
973985379 4:56347315-56347337 CCGTTGTTTAAAGGGGAAGAAGG + Intronic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
977921897 4:102654249-102654271 CTGTTGTTTCAGAGTGAAGGAGG - Intronic
985726507 5:1518729-1518751 CCTGTGTTCCAGTGGGAGGAAGG + Intronic
988092642 5:26562857-26562879 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
988267538 5:28971783-28971805 TCTTAGTTCCAGAGGGAGGAAGG - Intergenic
991142399 5:63259950-63259972 CTTTTGTTCCACAGGGAAGAAGG + Intergenic
991306799 5:65185359-65185381 CCCTTGTTCAAGAGGAAAAATGG - Intronic
992003371 5:72456053-72456075 CCTTTGTTCTAGAGAGGAGAAGG - Intronic
992121418 5:73597082-73597104 ACTTCATTCCAGAGGGAAGATGG + Intergenic
997400599 5:133598917-133598939 CCGTTGGTTCACCGGGAAGAGGG + Intronic
997599655 5:135130635-135130657 CCCTTGCTCCAGAGGGAGGTTGG - Intronic
998167439 5:139852198-139852220 CTGGTGCTCCCGAGGGAAGAAGG + Intronic
1003758827 6:9151652-9151674 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
1010802308 6:80190922-80190944 CCGTTGTTCCACAGTGTAGATGG + Intronic
1011626368 6:89286831-89286853 CTTGTGTTCCAGAGGGAAGCTGG + Intronic
1019721453 7:2574779-2574801 CCGATCTTCACGAGGGAAGACGG - Intronic
1021377880 7:19931290-19931312 TCGATGTTCCTGTGGGAAGAGGG + Intergenic
1022127566 7:27372954-27372976 CCTTTGTTCATGAGGAAAGATGG + Intergenic
1024619921 7:51148474-51148496 CCGCTGTGTCAGAGAGAAGATGG - Intronic
1027199510 7:76054352-76054374 CCCTTGTGCAAGAGGGCAGATGG - Intronic
1027499523 7:78931338-78931360 CAGTTATTCCAGGAGGAAGAGGG - Intronic
1029177039 7:98672111-98672133 CCCTGGATCCAGAGAGAAGATGG + Intergenic
1030182427 7:106723673-106723695 CCATTGTTCCAGAAAGGAGAAGG - Intergenic
1031079387 7:117243399-117243421 CATATGTTCCAGAGGGGAGAGGG - Intergenic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1039366664 8:36935192-36935214 CTTTTGTTCCAGTGGGAAGAGGG - Intronic
1040946799 8:52893169-52893191 GCGGTGGTCCAGCGGGAAGATGG + Intergenic
1046699742 8:117386768-117386790 TTGTTGATCCAAAGGGAAGATGG - Intergenic
1050567835 9:6905044-6905066 CCATTGTTGCAGAGAGCAGATGG + Intronic
1052333877 9:27300022-27300044 AAGTTGTTCCAGGAGGAAGATGG + Intergenic
1053034845 9:34816157-34816179 CAGAAGTTCCAGTGGGAAGATGG - Intergenic
1058522012 9:105820927-105820949 CCCATGATCCAGAGGGCAGAAGG - Intergenic
1185567746 X:1108704-1108726 CGTTTCTTCAAGAGGGAAGACGG - Intergenic
1185747190 X:2583246-2583268 CCCCTGCTCCAGAGGGGAGAGGG - Intergenic
1186289031 X:8076695-8076717 CCGCTGTTGAAGAGAGAAGAAGG + Intergenic
1188844259 X:35053915-35053937 CCTTTGTTCCTGATGGAAGAGGG + Intergenic
1190335861 X:49261329-49261351 ACGTTGTTCCAGAGTGGACAGGG - Intronic
1191629811 X:63311026-63311048 TCTTAGTTCCAGAGGGAGGAAGG - Intergenic
1193992443 X:88324525-88324547 CCATTCTTGCAGAGGTAAGATGG + Intergenic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1195079633 X:101358686-101358708 TCGTTGTTTCAGGGGAAAGAAGG - Exonic
1195348824 X:103977839-103977861 CCCTTGGTCAAGAGGGAAAAGGG + Intergenic
1195358619 X:104061000-104061022 CCCTTGGTCAAGAGGGAAAAGGG - Intergenic