ID: 1090382011

View in Genome Browser
Species Human (GRCh38)
Location 11:126333989-126334011
Sequence CAGAATTAATTGGTGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090382002_1090382011 18 Left 1090382002 11:126333948-126333970 CCTAAACGGTTTTAAGCATGTGG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1090382011 11:126333989-126334011 CAGAATTAATTGGTGGAGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 201
1090382001_1090382011 19 Left 1090382001 11:126333947-126333969 CCCTAAACGGTTTTAAGCATGTG 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1090382011 11:126333989-126334011 CAGAATTAATTGGTGGAGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090382011 Original CRISPR CAGAATTAATTGGTGGAGTG GGG Intronic
901105277 1:6750982-6751004 AAAAATTAATTAGTGGGGTGTGG - Intergenic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
903202663 1:21755075-21755097 CAGAATTAATTAGAGAAATGAGG - Intronic
903696345 1:25210281-25210303 CAGAATTGATTGGTGGTTGGTGG - Intergenic
904319973 1:29690247-29690269 GAGAATTAAGAGCTGGAGTGAGG - Intergenic
906819555 1:48914966-48914988 CTGATTTAATTGGTTTAGTGTGG - Intronic
907316701 1:53577052-53577074 CAGCATTTATTGGGGGAGGGAGG - Intronic
909516167 1:76509755-76509777 AAGCAGAAATTGGTGGAGTGGGG - Intronic
912306289 1:108570910-108570932 CAGAATTAGTTGGTGGGGAGGGG + Intronic
914934856 1:151969330-151969352 CAGAATTAATTGGTTGCTGGTGG + Intergenic
915206063 1:154271312-154271334 CAGAACTAAATCTTGGAGTGGGG + Intronic
915931579 1:160063630-160063652 CAGAATTTTTTTGTGGAGAGTGG - Intronic
916373687 1:164127746-164127768 GAGAATTGAGTGGTGGAGGGGGG - Intergenic
916442477 1:164841250-164841272 GAGATGTAATTGGAGGAGTGAGG + Intronic
919225854 1:194700257-194700279 CATTATTAATTTTTGGAGTGAGG + Intergenic
922192577 1:223332626-223332648 CAGAATTACTTGCTACAGTGTGG - Intronic
1063399080 10:5723756-5723778 CAGAATTACTTGGAGGAGAAAGG + Exonic
1064982718 10:21180508-21180530 CAAAATTAAATGGAGAAGTGAGG - Intergenic
1066211755 10:33246994-33247016 CAGTATTAATGGGTTGAGCGTGG - Intronic
1068583513 10:58770387-58770409 CATAATTACTTGGTGGAGAAAGG - Intronic
1069389634 10:67919912-67919934 CAGATTTAATTGGTGTAAGGTGG + Intergenic
1074341065 10:112630581-112630603 TAGTATTAAGTGGTGGAGTCAGG + Intronic
1078072964 11:8130469-8130491 CAGAATTTATTGGAAGAATGTGG - Intronic
1079149132 11:17882261-17882283 CAAAAATAATTGGTGGGGCGTGG + Intronic
1081460182 11:43265579-43265601 CAGGAATAATTGGTGTAATGTGG - Intergenic
1083742730 11:64719632-64719654 TGGAATGACTTGGTGGAGTGGGG + Intronic
1084139994 11:67220387-67220409 CAGAATAATTTGGTGTAATGGGG + Intronic
1085820084 11:79783152-79783174 CTGTAGTAAGTGGTGGAGTGTGG + Intergenic
1087909016 11:103731241-103731263 CAGATTTAATTGATAGGGTGTGG - Intergenic
1088778165 11:113107136-113107158 CAGAAATACTTGGGAGAGTGTGG + Intronic
1088914094 11:114213859-114213881 CAGTAGTAAGTGGTGAAGTGGGG + Intronic
1089008985 11:115117714-115117736 TAGAATTCACTGGTGGAGGGTGG + Intergenic
1089167804 11:116490676-116490698 AAGAATTAACAGGTGGGGTGTGG - Intergenic
1089582819 11:119492134-119492156 CAGAATCAATTGATGGAGAGAGG + Intergenic
1090382011 11:126333989-126334011 CAGAATTAATTGGTGGAGTGGGG + Intronic
1091582523 12:1798009-1798031 CAGGCTCAATGGGTGGAGTGTGG - Intronic
1093758731 12:22881395-22881417 CAGACTCAGTTGGTGGAGTAGGG - Intergenic
1094185289 12:27635595-27635617 CCGAATTAAATTGTGGAGTTGGG + Intronic
1095546038 12:43371530-43371552 GAGAATTTAGTGGTGGAGAGTGG + Intronic
1097474470 12:60036401-60036423 AAGAATTAATTGGTTTAATGAGG - Intergenic
1099289067 12:80752570-80752592 AAGAATTGATTGTTGGTGTGGGG + Intergenic
1099692288 12:85972523-85972545 CAGTATTAATTGTTAAAGTGTGG + Exonic
1102639406 12:114353560-114353582 CTGAATTAATTGTTGGAGCCAGG - Intergenic
1103891949 12:124246045-124246067 CAGAACTAAGGGGTGGAGAGGGG - Intronic
1106853907 13:33826928-33826950 CATAATTAATTGCTGGATTTTGG + Intronic
1107442213 13:40438155-40438177 CAGAATGAATTTGTGCAATGGGG - Intergenic
1108204329 13:48072592-48072614 CAGAATCAATCTGTGGGGTGGGG + Intronic
1108871521 13:54992588-54992610 CTAAAATAATTGGTGGAGAGGGG - Intergenic
1109655204 13:65381770-65381792 GAGAAGTGATTGGTGGGGTGGGG - Intergenic
1110809349 13:79794397-79794419 CAGACTTAATTGTTTGAGTTTGG + Intergenic
1111968280 13:94883166-94883188 CAGAATAAATTGGAGGGCTGAGG - Intergenic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1115227742 14:31121932-31121954 CAGAGTTAAGTGGAAGAGTGAGG - Intronic
1115722842 14:36181954-36181976 CAAAATTAAATGCTGGGGTGGGG - Intergenic
1118013462 14:61633920-61633942 CTAAATTAATTGGTACAGTGAGG + Intronic
1118567549 14:67158418-67158440 GAGAATGAATTGGAGGAGGGTGG + Intronic
1118844897 14:69540308-69540330 AAGAATCAAATGGTGGTGTGGGG + Intergenic
1120045926 14:79806104-79806126 TAGAATTAATAGCTGGAGTTGGG + Intronic
1120504790 14:85341915-85341937 CATCATTAATGGGGGGAGTGTGG - Intergenic
1120662786 14:87270508-87270530 TACAAGTATTTGGTGGAGTGAGG + Intergenic
1120898732 14:89557599-89557621 CAGAATTGCTTGCTGGGGTGTGG + Intronic
1123134182 14:106012106-106012128 CAGTAGTAACTGGTGGAGTTGGG - Intergenic
1125239090 15:37552282-37552304 CAATAATAATTGGTGGAGTTGGG - Intergenic
1125273167 15:37962552-37962574 CAGAATGAATTGGGGGATGGGGG + Intronic
1126950065 15:53871075-53871097 CAAATTTATTTGGGGGAGTGGGG - Intergenic
1127039683 15:54960917-54960939 CAAAATTAGTTGGTGGAAGGAGG - Intergenic
1127269292 15:57386225-57386247 CAGAGGACATTGGTGGAGTGGGG + Intronic
1128690888 15:69723999-69724021 CAGAATTACAAGGTGGAGGGTGG + Intergenic
1129898436 15:79126334-79126356 CAGAATTAATAGGTGAAATGTGG - Intergenic
1130536851 15:84791874-84791896 CAGGATGAATTGTGGGAGTGGGG + Intronic
1131082647 15:89549668-89549690 CCGAATTAATTGTTCAAGTGGGG - Intergenic
1135341967 16:21656181-21656203 CAGCATTAACTGGGGGGGTGGGG - Exonic
1135700832 16:24631044-24631066 CAGAATGAATTGGCGCAGGGAGG - Intergenic
1138766005 16:59604854-59604876 CAGGATTAATTGGTGCAATTTGG - Intergenic
1140608948 16:76575158-76575180 TATAATTAAATGGTGGAGAGGGG - Intronic
1141357638 16:83363531-83363553 GAGAATTAGTTGGTGGTGAGAGG + Intronic
1143300127 17:5902719-5902741 CAGTATTAGGTGGAGGAGTGTGG + Intronic
1144445787 17:15326870-15326892 CAGATTTAATTGGTGGAAGGTGG + Intronic
1146629598 17:34460279-34460301 ATGAATGAATTGGTGGAGTTTGG + Intergenic
1150332121 17:64302873-64302895 CAGAAGTAATAGGTGGAGCTGGG + Intergenic
1154233415 18:12579846-12579868 CAGAGTGAAGTGGTAGAGTGAGG - Intronic
1155506763 18:26541032-26541054 CAGAATGGGCTGGTGGAGTGGGG + Intronic
1159745105 18:72223736-72223758 CAGAAATAACTTGTGGAGTAAGG - Intergenic
1163433751 19:17283068-17283090 CAGAACCAATGGGTGGGGTGGGG - Intronic
1165696179 19:37902706-37902728 CAGCATTAGTTGGTGGCCTGAGG + Intronic
1167180600 19:47900426-47900448 AAGAAATAATTGAGGGAGTGAGG - Intergenic
926924221 2:17970374-17970396 CAGCATTAAGTGGTGGAGACAGG - Intronic
927336729 2:21933147-21933169 CAGAAGAACTTGGGGGAGTGTGG - Intergenic
927483125 2:23469905-23469927 CTGTATTAACTGGTAGAGTGAGG + Intronic
929178824 2:39010667-39010689 CAGAATTAGTTGGAAGTGTGTGG - Exonic
929643713 2:43607154-43607176 TAGATTAAATTGGGGGAGTGGGG - Intergenic
930899536 2:56486765-56486787 CAGAATAAATTGTAGGATTGAGG - Intergenic
931618489 2:64186323-64186345 CACAAGTATTTGGTGGGGTGGGG + Intergenic
931629890 2:64289265-64289287 CTGATTTAATTGGTCGAGTATGG - Intergenic
935949592 2:108316720-108316742 CAGAATTCGTCGGGGGAGTGGGG - Intergenic
937812484 2:126214324-126214346 CAAAATTAATATGTGTAGTGGGG - Intergenic
941647833 2:168060140-168060162 GAGAAATTATTGTTGGAGTGGGG - Intronic
942403497 2:175628500-175628522 CAGATTGAATTGGTAGACTGAGG + Intergenic
942639340 2:178044873-178044895 CAAAAATAATAAGTGGAGTGGGG - Intronic
943505218 2:188747091-188747113 CAGACTCAGTAGGTGGAGTGAGG - Intronic
943913742 2:193601688-193601710 AAGAGTGAATTGGTGGAGAGAGG + Intergenic
945340073 2:208641749-208641771 CTGAATTAATTGGCTGACTGTGG - Intronic
946807731 2:223488187-223488209 AAGAAATAATAGATGGAGTGGGG + Intergenic
947056177 2:226107258-226107280 AAGAATTAAATGGGGGGGTGGGG + Intergenic
1172303127 20:33863541-33863563 CAGAGAAAATTGGTGGAGTGGGG - Intergenic
1175562537 20:59942570-59942592 CAGATTGAATATGTGGAGTGGGG + Intronic
1177128782 21:17230409-17230431 AAGAATTGATTAGTTGAGTGTGG + Intergenic
1178784078 21:35636122-35636144 CTGGATTACTGGGTGGAGTGTGG + Intronic
1178831564 21:36060840-36060862 CAGAATGAAACGGTGGAATGGGG - Intronic
1179312488 21:40209045-40209067 CAGGATTAATTGTAGGGGTGAGG + Intronic
1179536109 21:42053849-42053871 AAAAATTAATTAGTTGAGTGCGG - Intergenic
1180819538 22:18816591-18816613 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
1181205764 22:21251036-21251058 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
1181958585 22:26606224-26606246 CAGAATTAATTGGTCTGGGGTGG + Intronic
1182031673 22:27163848-27163870 CAGCATGGATGGGTGGAGTGCGG - Intergenic
1182743671 22:32587948-32587970 AAGCAGTAAATGGTGGAGTGGGG - Intronic
1183694661 22:39414931-39414953 CAGAAGGAATAGGTGAAGTGGGG + Intronic
1203221157 22_KI270731v1_random:44377-44399 CAGAGTGAGTAGGTGGAGTGGGG + Intergenic
1203269668 22_KI270734v1_random:42444-42466 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
949167194 3:957055-957077 AAGAATTAATTAGTAGAGAGGGG + Intergenic
952631000 3:35467012-35467034 AAGAATTCATTTGTGGAGGGGGG + Intergenic
954079211 3:48203189-48203211 CAGGACTAATTGGTGGACTTTGG + Intergenic
955444556 3:58995733-58995755 CAGAATAAAATGGTGGAGTAAGG + Intronic
955768470 3:62368555-62368577 CTGAGTTACTTGGCGGAGTGAGG + Intergenic
956556845 3:70533882-70533904 AAAAATTAACTGGTGGACTGGGG - Intergenic
956648586 3:71481909-71481931 AAGAGTGAATTTGTGGAGTGGGG - Intronic
959079075 3:101780606-101780628 CTGATTTAATTGTTTGAGTGGGG + Intronic
959187075 3:103057897-103057919 AAGAATATATTGGTGGAGTTCGG - Intergenic
961684451 3:128619730-128619752 CAGAATGGAGTAGTGGAGTGAGG - Intergenic
962206942 3:133442539-133442561 CAGAATGCATTGGAGGAGGGAGG + Intronic
962558146 3:136577487-136577509 CAGAATTACTTGGAGGATGGGGG - Intronic
964528986 3:157646578-157646600 CAGAATAGAAAGGTGGAGTGAGG + Intronic
966717807 3:183031124-183031146 CAGAAGTTATTGGTGGAGTCAGG - Intronic
972246494 4:37250409-37250431 CAGCATTAAATTGTGGATTGAGG - Intronic
974137887 4:57842086-57842108 CAGAATTTATTGGTTTTGTGTGG + Intergenic
974295499 4:59994036-59994058 GAGAATTAATTGGTGGACAGAGG + Intergenic
974887291 4:67835215-67835237 CAGAATTACTTGTTGGGGTTGGG + Intronic
978283324 4:107043767-107043789 CAGTGTTAAGTGGTGGGGTGAGG - Intronic
978413075 4:108446434-108446456 CAGAATAAATAAGTGAAGTGGGG - Intergenic
979969850 4:127121035-127121057 CAGTTTTAATTTGTGGAGTGGGG - Intergenic
980110923 4:128636074-128636096 CTGAGTTAAATAGTGGAGTGAGG + Intergenic
980200003 4:129644155-129644177 AAGAATTTATTGGTGGAGAATGG - Intergenic
981325138 4:143437734-143437756 CAGATTTAATAGGTGGAGTTGGG + Intronic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
983768337 4:171516446-171516468 AAAAACTAATTGGTAGAGTGTGG + Intergenic
985828122 5:2207830-2207852 CACATTTAATCGGTGGACTGAGG - Intergenic
987387422 5:17343224-17343246 AATAATTTATTGGTGGGGTGTGG + Intergenic
987940975 5:24536193-24536215 TAGAGTTAATTAGTGGAGAGGGG - Intronic
988785170 5:34560074-34560096 CAGAAGTAATTGTTGAAATGAGG - Intergenic
991992092 5:72349908-72349930 CAGAAATAGTTGCTGGAGGGAGG + Intronic
993538616 5:89119943-89119965 CAGGATTTGGTGGTGGAGTGTGG + Intergenic
993743952 5:91573235-91573257 AAGAATTAAAGGATGGAGTGGGG - Intergenic
994348162 5:98713101-98713123 CAGAATTACTTGCTTGACTGAGG + Intergenic
994991714 5:107004956-107004978 CATATTTAATTGGGGGAGGGTGG - Intergenic
996073886 5:119165948-119165970 ATGAATTAAATGGTGGAGTCTGG + Intronic
996492615 5:124115864-124115886 CACACTTAATTGTTGGGGTGAGG - Intergenic
996795398 5:127341151-127341173 CAGAATGAACTGGTGAAGTGGGG - Intronic
997269651 5:132526129-132526151 CAGAATGAATGGATGGAGGGAGG - Intergenic
997610856 5:135214851-135214873 TAGAATTAAATGCTAGAGTGGGG + Intronic
1000915242 5:167073642-167073664 CCAAATTATTTGGTGGGGTGAGG - Intergenic
1001234360 5:170017024-170017046 GAGAATGAAATGGTGGAGTCAGG - Intronic
1004592235 6:17063779-17063801 AAGAATTATTTGGTGGAGGGTGG + Intergenic
1006794528 6:36723157-36723179 CAGAATGTATTTGTAGAGTGTGG + Intronic
1008032337 6:46711075-46711097 CAAAATTAAGTGGTGGAGCCAGG + Intronic
1009324176 6:62329557-62329579 CAGAATTCATTGTGGTAGTGTGG + Intergenic
1010050326 6:71496650-71496672 CAGAAAAATTTTGTGGAGTGGGG - Intergenic
1010188528 6:73169816-73169838 CAGTTTTAAGTGGTGGGGTGAGG - Exonic
1010550515 6:77216645-77216667 CATAAAATATTGGTGGAGTGGGG + Intergenic
1013021282 6:106222193-106222215 AAGAATTTATTTGTGGAGAGAGG + Intronic
1013445012 6:110216384-110216406 CAGTATTAATTTGTGCAGGGAGG - Intronic
1013542756 6:111127403-111127425 CACATTTTATTGGTGCAGTGTGG + Intronic
1017619857 6:156285484-156285506 TAAAATTATTTGCTGGAGTGAGG - Intergenic
1020791397 7:12632470-12632492 CAGAATGGATTGGTGGAGGAAGG + Intronic
1020926227 7:14329281-14329303 CAGAATCAAGTGCTAGAGTGTGG + Intronic
1021479467 7:21100121-21100143 CATTATTAATAGGTGTAGTGTGG - Intergenic
1025922636 7:65927867-65927889 CTAAATTATTTGGTGGGGTGGGG + Intronic
1026055056 7:66976530-66976552 CAGAATTAAGCGGTGGGGGGGGG + Intergenic
1027297837 7:76796311-76796333 TGGCATTATTTGGTGGAGTGGGG - Intergenic
1030275640 7:107718672-107718694 CAGAAATATTTGGTGGGGTGGGG + Intergenic
1031957142 7:127954166-127954188 CAGAAATATTTGCTGGAGTAAGG - Intronic
1032715970 7:134509791-134509813 GTGAATTAATTGGTAGAGAGGGG - Intergenic
1033103776 7:138500405-138500427 CAAAAAAAATTAGTGGAGTGTGG + Intronic
1037526838 8:19733340-19733362 CATTAATAATTGGTGGAGTGTGG - Intronic
1038006160 8:23432427-23432449 CAGCATTAAATTGAGGAGTGGGG - Exonic
1038897947 8:31807765-31807787 CAGAATCAAATTGTGGAATGGGG - Intronic
1039418128 8:37413276-37413298 CAGAATTAATTAGTCCAGAGTGG + Intergenic
1039449672 8:37662008-37662030 CAGAATTAAATGGAGAAGAGTGG + Intergenic
1039532276 8:38273843-38273865 CAGAATTAATTGCTGGAGTCAGG + Exonic
1040766865 8:50921875-50921897 CTCAATTTATTGGTGGATTGTGG - Intergenic
1043452457 8:80381851-80381873 CAAAATTAGCTGGTGGCGTGTGG - Intergenic
1044065770 8:87698497-87698519 CAGACTTAATTGGTCTAGGGTGG + Intergenic
1044525141 8:93242469-93242491 CAGGAATAAATGGTAGAGTGGGG + Intergenic
1044701222 8:94966978-94967000 CTGATTTAGTTGGTGCAGTGAGG - Intronic
1047298549 8:123592440-123592462 GAGAATTCGTTGTTGGAGTGGGG - Intergenic
1049736362 8:144208547-144208569 CAGAATTAATAAGTTGAGAGGGG - Intronic
1050556578 9:6794561-6794583 AAGAATGAATTGGTGTTGTGGGG + Intronic
1055596074 9:77865560-77865582 CAAATTTAATTGCTGGAGAGAGG + Intronic
1055794890 9:79965160-79965182 CAAAGCTAAATGGTGGAGTGAGG + Intergenic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1058301203 9:103375239-103375261 TAGAATTTTATGGTGGAGTGAGG + Intergenic
1059431024 9:114250417-114250439 CAGAACCATCTGGTGGAGTGAGG + Intronic
1059852378 9:118357931-118357953 GAAAATTAATTGCTAGAGTGTGG - Intergenic
1061402875 9:130378015-130378037 CAGAATTGAGTGGTGGAGCCTGG + Intronic
1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG + Intronic
1186074112 X:5857884-5857906 AAGAGTTAATTGGTGGAGAATGG + Intronic
1186171098 X:6877839-6877861 CAGCATTACTTGAGGGAGTGGGG - Intergenic
1187057032 X:15750572-15750594 CAGAAATAATTTGTGGTTTGTGG - Intronic
1187296426 X:18005668-18005690 CACTATTAATTGGTGGTTTGGGG + Intergenic
1188173208 X:26954598-26954620 CAGAATTATTTGGTGTTGTCAGG - Intergenic
1188433621 X:30135367-30135389 CAGAATCTAGTGGTGAAGTGAGG - Intergenic
1190390948 X:49931052-49931074 CAGATTTAATTGGCTGAGTGAGG - Intronic
1190449716 X:50566448-50566470 CTGATTTAATTGGTGCGGTGGGG - Intergenic
1192462648 X:71330502-71330524 AAGAATAAATTAGTTGAGTGTGG - Intergenic
1194712907 X:97257112-97257134 CTGAATTAATTAATGAAGTGAGG + Intronic
1196849060 X:119920163-119920185 GAGGATTAGTTGCTGGAGTGGGG + Intronic
1198390112 X:136165733-136165755 CACAATTGATTGGTGATGTGGGG + Intronic
1200337200 X:155362977-155362999 AAGAGGTAATTGATGGAGTGAGG + Intergenic
1200349270 X:155478250-155478272 AAGAGGTAATTGATGGAGTGAGG - Intergenic