ID: 1090383277

View in Genome Browser
Species Human (GRCh38)
Location 11:126341862-126341884
Sequence GCTCATCTGCAGAAGGTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090383271_1090383277 18 Left 1090383271 11:126341821-126341843 CCTGGTGCATGTAGCTCAGCTAC 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1090383277 11:126341862-126341884 GCTCATCTGCAGAAGGTCTAAGG 0: 1
1: 0
2: 2
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090383277 Original CRISPR GCTCATCTGCAGAAGGTCTA AGG Intronic
903883980 1:26530588-26530610 AATCATCTTCACAAGGTCTAAGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904138642 1:28334141-28334163 GCTCATCTCCAGCAGGCCTGGGG - Intronic
904453921 1:30635637-30635659 GCTCATCTGCAGATGGCCTATGG + Intergenic
905969707 1:42132210-42132232 GGTCATCTGCACAACCTCTAGGG + Intergenic
913121132 1:115741895-115741917 ACTCTTCTGCAGAACGTCCAGGG + Intronic
917315104 1:173715862-173715884 GTGCATCTGCAGAAGGCCTGTGG + Intronic
924333814 1:242966916-242966938 GCTCATCAAAAGAAGGTCTTAGG + Intergenic
1063061706 10:2562053-2562075 GCTCATCTGCAGACAGTATCAGG + Intergenic
1064905578 10:20342336-20342358 GATCATCTGCAGAATGGCTGAGG + Intergenic
1072352267 10:94568247-94568269 GCTCAACTGCATAATGTGTAAGG - Intronic
1074941051 10:118236268-118236290 GTTCTTCAGCAGAAGGTCTGTGG + Intergenic
1076837624 10:133029050-133029072 GGGCATCTGCAGAGGGTCCAAGG + Intergenic
1078511136 11:11985108-11985130 GGCCATGTGCAGATGGTCTAGGG + Intronic
1079307780 11:19338910-19338932 CCTCATCTGCAGAATGGCTGTGG - Intergenic
1080382393 11:31787200-31787222 GCTCAGCTGCAGAAGCCCTCTGG - Exonic
1084019447 11:66409117-66409139 GCGCATCAGCAGAAGGGCTGCGG - Intergenic
1084179151 11:67437953-67437975 ACACATGTGCAGAAGGTCTGGGG - Exonic
1087863796 11:103197807-103197829 GATCATCTCCAGAAGGGCAAAGG - Intronic
1088794215 11:113253836-113253858 GTTCATTTGCAGTAGGTCTAGGG + Intronic
1090383277 11:126341862-126341884 GCTCATCTGCAGAAGGTCTAAGG + Intronic
1096011095 12:48215993-48216015 GCTCAGCTGGAGAAGGGATAGGG + Intergenic
1097193481 12:57231475-57231497 GCTCGGCTGCAGAAGTTCTGGGG - Exonic
1097904759 12:64908389-64908411 GCTCAGGTGCAGAAGGGCTCTGG + Intergenic
1099083856 12:78220597-78220619 GCTCATCTGCAGAAGCCTTGGGG + Intergenic
1113166907 13:107452766-107452788 GCTCATAGGCAGAAGGCTTATGG - Intronic
1123669534 15:22641256-22641278 GCCCATCTTAAGAAGTTCTAAGG + Intergenic
1124525510 15:30447696-30447718 GCCCATCTTAAGAAGTTCTAAGG + Intergenic
1124773144 15:32559988-32560010 GCCCATCTTAAGAAGTTCTAAGG - Intergenic
1126596433 15:50388401-50388423 TCTCTTCTGCAGAAGGTTTTGGG - Intergenic
1128686108 15:69686951-69686973 GCTCATCTGAATAGGTTCTAAGG - Intergenic
1130922064 15:88355856-88355878 GACCATCTGCAGAGGGTTTAGGG + Intergenic
1134391992 16:13828772-13828794 GCACATGTGTAGGAGGTCTAAGG - Intergenic
1135103587 16:19627736-19627758 GTTCATCGCCACAAGGTCTATGG + Exonic
1140748219 16:77999624-77999646 GGTCATTTACAGAAGGTCTCTGG + Intergenic
1142485541 17:245666-245688 GCTCAGCAGGAGAAGGTCTGAGG + Intronic
1143239803 17:5434327-5434349 GCTCTTGGGCAGAATGTCTAGGG + Intronic
1147649092 17:42051736-42051758 GCTCTTCTGCAAAAGGCCTAGGG + Intronic
1149142363 17:53447773-53447795 GGTCATCGGCAGAAGGTGAAGGG + Intergenic
1149173837 17:53845579-53845601 GCTCGTCCCCAGAAGCTCTAGGG + Intergenic
1150248586 17:63693720-63693742 GCTCCTCAGCTGAAGGTCTCTGG - Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1155991448 18:32283109-32283131 GCTCAGCTGCAACAGTTCTAGGG + Intronic
1158306377 18:56110455-56110477 GCTCTTCTGCAGAGGGTTCAAGG - Intergenic
1158790267 18:60771935-60771957 GCTCATCTGCAGTATCTCCAAGG - Intergenic
927502674 2:23592821-23592843 GCTTACCTGCAGAAGGTCACCGG - Intronic
930037137 2:47093544-47093566 GGCCATCTGCAGAATGGCTAAGG + Intronic
930745294 2:54876524-54876546 TGTCATCTGAAGAAGGCCTAAGG - Intronic
937133149 2:119528383-119528405 GCTGATCTGAAGAAGGCTTAAGG + Intergenic
937734480 2:125273041-125273063 GCTCTTCTGCACAAAGTCCATGG - Intergenic
944321876 2:198355393-198355415 GATAATCTGCAGAAGGTAAATGG + Intronic
944979393 2:205097604-205097626 GTTCTACTGCAGTAGGTCTAGGG - Intronic
948779305 2:240308187-240308209 GCTAATTTGCAGAAGGACTCTGG + Intergenic
948847234 2:240688865-240688887 GGTCACCTGCAGAAGGCCTTGGG + Intergenic
1170541621 20:17394634-17394656 TGTCATCTCCAAAAGGTCTAGGG + Intronic
1173131108 20:40394415-40394437 CCTCCTCTGCAGATGCTCTATGG + Intergenic
1175366319 20:58458736-58458758 GCTCAACTTCTGAAGGTCTGGGG + Intergenic
1176249737 20:64114835-64114857 GCCCATCAGCAGGAGGTCCAGGG - Intergenic
1176848110 21:13892083-13892105 GCTGAGCTGCTGAAGGTCTTGGG - Intergenic
1177450355 21:21258235-21258257 TCACATCTGCTGAAGTTCTAGGG + Intronic
1181393214 22:22599169-22599191 GCTCATCTGAAGGGTGTCTAAGG + Intergenic
1181638588 22:24185474-24185496 GCTGCTCTGCAGACGGACTACGG + Exonic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
951473688 3:23082346-23082368 GTTCAAATGCAGAAGGTCCATGG + Intergenic
952854133 3:37753610-37753632 GTACATCTGCAGAAGGCATACGG - Intronic
961619277 3:128210799-128210821 GCTCTTCTGCAGAAGATAAAAGG - Intronic
966777464 3:183555563-183555585 GCTCATCTGTAGAAGGTGCCAGG + Exonic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967482241 3:189986806-189986828 AATCAGCTGCAGAAGGTCTGGGG - Exonic
968107414 3:196011760-196011782 GGGCATCAGCAGAAGGTCTATGG + Intergenic
972538481 4:40018893-40018915 GATCATTTGCAAAAGGTTTAGGG - Intergenic
975234212 4:71972432-71972454 GTTGATCTCCAGAAAGTCTATGG + Intergenic
977957361 4:103045579-103045601 GCTCAGATCCAAAAGGTCTAAGG + Intronic
978291645 4:107149023-107149045 GCTCATTTGCAGAATGACTTAGG - Intronic
982343996 4:154335745-154335767 GCAAATATGCAGAAGGTCTTTGG - Intronic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
988066729 5:26234668-26234690 GGGCATCTGCAGAAGGTCTATGG + Intergenic
991666053 5:69001036-69001058 GCTTAACTGCAAAAGGTCTGGGG + Intergenic
997752583 5:136361514-136361536 GCTCATCTGCAGCTGGACTTAGG - Intronic
1002607077 5:180389856-180389878 GCCCATGTGCAGCAGGTCCAGGG - Intergenic
1004763259 6:18694866-18694888 ACTCATCTGAAGAAGATCTTGGG + Intergenic
1005465877 6:26112738-26112760 GGTCATCTGCAGCATGTCTAGGG - Intergenic
1006787362 6:36677639-36677661 CCTCATTTGCAGATGGTTTATGG - Intronic
1007138015 6:39541703-39541725 CCTAATCTGAAGAAGGTCAAGGG + Intronic
1012787043 6:103643860-103643882 GATCATCTGCAGACTGACTATGG + Intergenic
1023060668 7:36322893-36322915 GGGCATCTGCAGGAGGTCTCAGG + Intergenic
1024058592 7:45682118-45682140 GCTCATTTGCACAAAGTCTGTGG + Intronic
1024166630 7:46739799-46739821 GCTCATCTGAAAAAAGTCTGTGG - Intronic
1025161210 7:56662795-56662817 TCACACCTGCAGAAGGTCCAGGG - Intergenic
1033141375 7:138829953-138829975 GAGCCTCTGCAGAAGGTCTGTGG + Intronic
1036512937 8:9417433-9417455 ACTGAGCTGCAGAAGGCCTAGGG - Intergenic
1039747692 8:40444756-40444778 TTTCATCTGCAGTATGTCTAGGG - Intergenic
1042215065 8:66423026-66423048 GCTCATATGCAGAAAGGCAATGG - Intergenic
1043442694 8:80290340-80290362 GGTCTTCTTCAGAAGGGCTATGG - Intergenic
1046538058 8:115542005-115542027 TCTCTTTTGCAGAAGTTCTATGG - Intronic
1047373121 8:124272677-124272699 GCTCATCTATGGAAGGTCTAAGG - Intergenic
1048206341 8:132418235-132418257 GCTCCTCTTCAGAAAGCCTATGG - Intronic
1049539186 8:143199573-143199595 GCTCAGCAGCAGAAGGGCTCAGG - Intergenic
1053577134 9:39364348-39364370 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1053841638 9:42192273-42192295 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054098705 9:60923038-60923060 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054120105 9:61198667-61198689 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054587651 9:66983895-66983917 ACTGAGCTGCAGAAGGGCTAAGG + Intergenic
1055238264 9:74150788-74150810 GCACATTTGAAGAAGATCTATGG - Intergenic
1055350332 9:75380013-75380035 TCTTATCTGCAGAAGTTCCACGG - Intergenic
1055727062 9:79241925-79241947 GATCAGCTGCAACAGGTCTATGG - Intergenic
1056605284 9:88080265-88080287 GGTCATGTGCAGAAGAGCTAAGG - Intergenic
1058332368 9:103778810-103778832 GCTAATATCCAGAATGTCTAAGG + Intergenic
1060395839 9:123315769-123315791 GCTCATCTGGAAAAGGTCACAGG - Intergenic
1186108803 X:6233466-6233488 TCCCATCTGCAGAAGATCTTTGG + Intergenic
1189768702 X:44399791-44399813 GCTCATGTGCAAAAGGCCTTTGG - Intergenic