ID: 1090384407

View in Genome Browser
Species Human (GRCh38)
Location 11:126348227-126348249
Sequence TCTCGACTCCCCCGAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090384402_1090384407 -5 Left 1090384402 11:126348209-126348231 CCCACACTCTGGAAGGTTTCTCG No data
Right 1090384407 11:126348227-126348249 TCTCGACTCCCCCGAGGGGCTGG No data
1090384403_1090384407 -6 Left 1090384403 11:126348210-126348232 CCACACTCTGGAAGGTTTCTCGA No data
Right 1090384407 11:126348227-126348249 TCTCGACTCCCCCGAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090384407 Original CRISPR TCTCGACTCCCCCGAGGGGC TGG Intergenic
No off target data available for this crispr