ID: 1090385941

View in Genome Browser
Species Human (GRCh38)
Location 11:126357577-126357599
Sequence GTCTAACGAGGTTGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090385941_1090385946 -10 Left 1090385941 11:126357577-126357599 CCAGCCTCCCAACCTCGTTAGAC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1090385946 11:126357590-126357612 CTCGTTAGACTCCTAGAATCCGG 0: 1
1: 0
2: 0
3: 8
4: 108
1090385941_1090385950 26 Left 1090385941 11:126357577-126357599 CCAGCCTCCCAACCTCGTTAGAC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1090385950 11:126357626-126357648 ACTAAGAATCTGCTCCTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 184
1090385941_1090385947 -2 Left 1090385941 11:126357577-126357599 CCAGCCTCCCAACCTCGTTAGAC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1090385947 11:126357598-126357620 ACTCCTAGAATCCGGTTTTCTGG 0: 1
1: 0
2: 1
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090385941 Original CRISPR GTCTAACGAGGTTGGGAGGC TGG (reversed) Intronic
900476454 1:2878580-2878602 GTCTAAAGAGGGTGAGGGGCTGG + Intergenic
904638569 1:31903821-31903843 GTTTCACCATGTTGGGAGGCTGG + Intergenic
906196483 1:43933592-43933614 GTCCCCCGAGGTTGGGAGGGGGG - Exonic
908043948 1:60148030-60148052 ATCTAATGAGGCTTGGAGGCTGG + Intergenic
908348469 1:63260298-63260320 AGCTAACGAGATTGGAAGGCAGG - Intergenic
910609523 1:89126795-89126817 GTCTTACTATGTTGTGAGGCTGG + Intronic
912357210 1:109064126-109064148 GTCTCACTATGTTGGCAGGCTGG - Exonic
913088617 1:115460879-115460901 GTGTAACTAGGTAGGGGGGCAGG - Intergenic
914000467 1:143690514-143690536 ATCAAATGAGATTGGGAGGCAGG - Intergenic
914097093 1:144553306-144553328 GTTTCACCAGGTTGGCAGGCTGG + Intergenic
914301902 1:146384304-146384326 GTTTCACCAGGTTGGCAGGCTGG - Intergenic
916379595 1:164195288-164195310 GGCAAACGAGGATGGGTGGCTGG + Intergenic
916938300 1:169654304-169654326 GTCTTACTTGGTTGTGAGGCAGG - Intergenic
922100780 1:222475595-222475617 GCCAAAGGAGGTTGTGAGGCAGG + Intergenic
922183566 1:223255358-223255380 GTCTAAAGAGGTTGGGGGGTGGG + Intronic
1065058756 10:21875271-21875293 GTCTCAGCAAGTTGGGAGGCTGG - Intronic
1067488646 10:46676800-46676822 GTCTCACTATGTTGGCAGGCTGG - Intergenic
1067606023 10:47663577-47663599 GTCTCACTATGTTGGCAGGCTGG + Intergenic
1071337788 10:84615351-84615373 CTCTAACAAGCTTGTGAGGCTGG + Intergenic
1071621576 10:87124936-87124958 GTCTCACTATGTTGGCAGGCTGG + Intronic
1072357952 10:94630687-94630709 GTCTCACTAGGTTGCCAGGCTGG + Intergenic
1073604841 10:104883785-104883807 CTCTAAGGAGGCTGGGAGGTAGG + Intronic
1075384531 10:122045974-122045996 GTCTCACCATGTTGGCAGGCTGG - Intronic
1083054751 11:59809438-59809460 GTTTCACCAGGTTGGCAGGCTGG + Intronic
1083948533 11:65940493-65940515 GTCATTCGAGTTTGGGAGGCAGG + Intergenic
1084654954 11:70509693-70509715 GTGTGATGGGGTTGGGAGGCGGG + Intronic
1085266293 11:75240034-75240056 GTCTTAAGAGGTTTGGGGGCAGG + Intergenic
1090385941 11:126357577-126357599 GTCTAACGAGGTTGGGAGGCTGG - Intronic
1092148714 12:6232518-6232540 GAATAAGGAGGTGGGGAGGCAGG + Intronic
1093893795 12:24554549-24554571 ATCCAAGGAGGATGGGAGGCAGG - Intergenic
1095356986 12:41286419-41286441 CTCTAAGGAGGTTGGGAGAGTGG - Intronic
1097272187 12:57782925-57782947 GTCAAACGAGGTTGGGAGGAAGG - Intronic
1099330291 12:81276259-81276281 GTCTCAGAAGGGTGGGAGGCTGG + Intronic
1103692183 12:122784224-122784246 GTCTAAATAGGCTGGGAGGCCGG + Intronic
1112710286 13:102119996-102120018 ATCTAGTGAGGTTGGGTGGCAGG - Intronic
1114680971 14:24483125-24483147 GCCTAAAGAGGGTAGGAGGCTGG - Intergenic
1115243126 14:31269103-31269125 GTCTCACCATGTTGGCAGGCTGG - Intergenic
1122573049 14:102721392-102721414 TTCTAAAGAGTTTAGGAGGCCGG + Intronic
1122820662 14:104343219-104343241 GCCTAACGAGGTGGGGAGTTGGG + Intergenic
1124887139 15:33697909-33697931 CTCTCATGAGGTTGGGATGCTGG - Exonic
1128459905 15:67859255-67859277 GTCTGACCAGGTTGCCAGGCTGG - Intergenic
1129380510 15:75162466-75162488 TTCTAATCATGTTGGGAGGCTGG - Intergenic
1132953534 16:2578462-2578484 GTCTAGGGTGGCTGGGAGGCAGG + Intronic
1132960818 16:2621705-2621727 GTCTAGGGTGGCTGGGAGGCAGG - Intergenic
1133260080 16:4543518-4543540 GTCTCACTAGGTTGCCAGGCTGG + Intergenic
1134455303 16:14390932-14390954 GTGCTATGAGGTTGGGAGGCAGG + Intergenic
1135547316 16:23374954-23374976 GTCTCCTGAGGTTGGGAGGGAGG - Intronic
1139425997 16:66880418-66880440 GGCTAAAGAGGATGAGAGGCGGG - Exonic
1140533220 16:75684549-75684571 GGCTAAGGAGGTTGTGTGGCAGG + Intronic
1146836851 17:36117924-36117946 GTCAAAGGTGGTGGGGAGGCGGG + Intergenic
1148853885 17:50568082-50568104 GTGTTGAGAGGTTGGGAGGCTGG + Intronic
1148962233 17:51402923-51402945 GTCTAATTAGGAAGGGAGGCTGG - Intergenic
1151749236 17:76027300-76027322 GTCTGGCGAGGTGGGGCGGCTGG + Exonic
1152544847 17:80995285-80995307 GTCTTAAGAGGCTGGGGGGCAGG + Intronic
1160809810 19:1008489-1008511 GTGGAGCCAGGTTGGGAGGCAGG - Intronic
1162288154 19:9756033-9756055 GTTTAACCATGTTGGCAGGCTGG + Intronic
1163209831 19:15832088-15832110 GTGAAAAGAGGTTGGGAGGAGGG - Intergenic
1166726250 19:45029652-45029674 GTTTCACCATGTTGGGAGGCTGG - Intronic
1168520537 19:57046898-57046920 GCAGAACGAGGTTGGGAGACAGG - Intergenic
936079665 2:109423682-109423704 GTCAAAGGAGGCTGGGCGGCTGG - Intronic
939959352 2:148552627-148552649 CTGTAACGATGTTGGGAGGGTGG + Intergenic
945291535 2:208132345-208132367 GTCTAACGAGAATGTTAGGCAGG - Intergenic
1169438879 20:5617419-5617441 GTTTCACCATGTTGGGAGGCTGG + Intergenic
1175047030 20:56116614-56116636 GGCTAACGTGGCTGGGAGGAGGG + Intergenic
1179808046 21:43852527-43852549 GTCAAACAAGGCTGGGAAGCTGG + Intergenic
1183330996 22:37221431-37221453 GTCTAAGGAGGATGAGAGACAGG + Intergenic
1184420796 22:44381860-44381882 GTCTAAGGAGGGTGAGAGGAAGG - Intergenic
950438232 3:12993267-12993289 GTCACACGGGGTTGGGAGGCAGG + Intronic
952725109 3:36575383-36575405 GACTAACGATGTTGGGTGGTGGG - Intergenic
953068565 3:39497523-39497545 GTCTAAAGTGCTTGGGATGCTGG + Intronic
953990756 3:47481367-47481389 GTTTCACCATGTTGGGAGGCTGG - Intergenic
969586587 4:8097560-8097582 CTCTAGCGAGGGTGGGAGGCTGG - Intronic
974197723 4:58598145-58598167 GTCTAAACAGGTTTGTAGGCCGG - Intergenic
975530709 4:75396571-75396593 GAAGAACGAGGTGGGGAGGCAGG - Intergenic
978768290 4:112427742-112427764 TTCTCAGGAGATTGGGAGGCAGG + Intronic
982053048 4:151522500-151522522 GTTTAACCAGGTTGGGAGAGAGG + Intronic
992763335 5:79971227-79971249 CTCAAAGGAGGTTGGGAGGGTGG - Intergenic
995768534 5:115645104-115645126 TCCTAACGAGGTTAGGAGGAGGG + Intergenic
998773831 5:145575952-145575974 GTAAAACGTGGTTGGGAGGATGG - Intronic
999730911 5:154476287-154476309 TTTAAACCAGGTTGGGAGGCTGG - Intronic
1004180397 6:13376184-13376206 GTCTAAGGAGGCAGGGAGGTGGG + Intronic
1006144277 6:31948986-31949008 GTCTGAGAAGGTGGGGAGGCTGG - Intronic
1006784772 6:36658938-36658960 GTGTAAGGAGGTGGGGAGGTTGG + Intergenic
1009873804 6:69480733-69480755 GTCTACAGAGGTAGGCAGGCAGG - Intergenic
1011721057 6:90157087-90157109 CTCTAAGGAGGTTGAGAGTCAGG - Intronic
1018145146 6:160878998-160879020 GTTTCACCATGTTGGGAGGCTGG - Intergenic
1018386763 6:163311565-163311587 GTCTAACTATGTTGAGAAGCAGG - Intronic
1019504006 7:1381527-1381549 TTCTAACAAGGAGGGGAGGCTGG - Intergenic
1019569735 7:1705260-1705282 GTTTAGCGAGGTGGGGAGGAGGG - Intronic
1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG + Intronic
1023355906 7:39366783-39366805 GTCTCAGGAGTTGGGGAGGCAGG + Intronic
1032002884 7:128276703-128276725 GTCTAAGGAAGTGGGGGGGCAGG + Intergenic
1032068972 7:128792119-128792141 TTCTGAGGAGGCTGGGAGGCAGG + Exonic
1032122002 7:129163382-129163404 GTCTCACTAGGTTGCCAGGCTGG + Intronic
1034334308 7:150310628-150310650 GTGAAAAGAGGTTGGGAGGAGGG - Intronic
1034614504 7:152403908-152403930 GACTCAGAAGGTTGGGAGGCTGG + Intronic
1038568517 8:28639563-28639585 GTATAAAGAGGTAGGCAGGCAGG - Intronic
1039585592 8:38704543-38704565 TTCTAACCAGGATGTGAGGCAGG + Intergenic
1043348056 8:79323211-79323233 TTGTAACGACATTGGGAGGCAGG - Intergenic
1044896921 8:96902387-96902409 GTCTATCGAGGTTTGAAGTCAGG - Intronic
1047428640 8:124770326-124770348 GTTTCACCAGGTTGGCAGGCTGG + Intergenic
1053289013 9:36867937-36867959 GCCCAACCAGGCTGGGAGGCTGG - Intronic
1059248975 9:112871309-112871331 GTCTCATGAGGTGAGGAGGCTGG + Exonic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061690178 9:132321221-132321243 GACTAAAGACATTGGGAGGCCGG + Intronic
1189091105 X:38083870-38083892 GACTATGGAAGTTGGGAGGCAGG - Intronic
1189165217 X:38854458-38854480 GTTTCACGATGTTGGCAGGCTGG - Intergenic
1189449998 X:41120155-41120177 TACTAATGAGGTTGAGAGGCAGG + Intronic
1190596685 X:52059314-52059336 GTCTCAGGAGGCTGGGAGGGCGG + Intergenic
1190612139 X:52194759-52194781 GTCTCAGGAGGCTGGGAGGGCGG - Intergenic
1191969317 X:66795940-66795962 GTCTAGAGATGTTGGGAGGCAGG + Intergenic
1196651365 X:118171652-118171674 GTCTCACTATGTTGTGAGGCTGG - Intergenic
1200128209 X:153828118-153828140 GTTTAAGGAGGCCGGGAGGCAGG + Intronic
1201153879 Y:11112287-11112309 GTATCACCATGTTGGGAGGCTGG + Intergenic