ID: 1090389921

View in Genome Browser
Species Human (GRCh38)
Location 11:126381971-126381993
Sequence CCCTCCCAGCCCACTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 1, 2: 1, 3: 50, 4: 414}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090389909_1090389921 7 Left 1090389909 11:126381941-126381963 CCCTGTGCCCTGCCAGGCTGGTC 0: 2
1: 0
2: 2
3: 48
4: 385
Right 1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG 0: 1
1: 1
2: 1
3: 50
4: 414
1090389907_1090389921 12 Left 1090389907 11:126381936-126381958 CCTTTCCCTGTGCCCTGCCAGGC 0: 2
1: 0
2: 5
3: 64
4: 616
Right 1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG 0: 1
1: 1
2: 1
3: 50
4: 414
1090389910_1090389921 6 Left 1090389910 11:126381942-126381964 CCTGTGCCCTGCCAGGCTGGTCC 0: 2
1: 1
2: 2
3: 49
4: 387
Right 1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG 0: 1
1: 1
2: 1
3: 50
4: 414
1090389914_1090389921 -1 Left 1090389914 11:126381949-126381971 CCTGCCAGGCTGGTCCCGGGCCC 0: 2
1: 1
2: 6
3: 45
4: 469
Right 1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG 0: 1
1: 1
2: 1
3: 50
4: 414
1090389915_1090389921 -5 Left 1090389915 11:126381953-126381975 CCAGGCTGGTCCCGGGCCCCCTC 0: 2
1: 1
2: 6
3: 50
4: 453
Right 1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG 0: 1
1: 1
2: 1
3: 50
4: 414
1090389913_1090389921 0 Left 1090389913 11:126381948-126381970 CCCTGCCAGGCTGGTCCCGGGCC 0: 2
1: 0
2: 3
3: 32
4: 323
Right 1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG 0: 1
1: 1
2: 1
3: 50
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090389921 Original CRISPR CCCTCCCAGCCCACTCATCC AGG Intronic
900575070 1:3379040-3379062 CCCTCCCAGCGCGCCCTTCCTGG + Intronic
900575401 1:3380063-3380085 CCCTCCCAACACACCCCTCCTGG + Intronic
900596253 1:3481480-3481502 TCCTCCCAGCCATCTCGTCCTGG + Intergenic
900987263 1:6080371-6080393 CCCCCCCAGCCTCCTCCTCCCGG - Intronic
900992551 1:6104622-6104644 CCCCCCCAGCCCACCCTCCCTGG + Exonic
901030614 1:6305170-6305192 CCCGGCCAGCCGCCTCATCCGGG - Intronic
901657062 1:10775487-10775509 CCCTTCCAACCCAGGCATCCTGG - Intronic
901773900 1:11545971-11545993 CACTCCGAGCTCACTCATCCTGG + Intergenic
902360009 1:15937247-15937269 CCCTCCCAGCTCGGTCAGCCCGG + Exonic
902746463 1:18477942-18477964 CCCACCCAGCCCACTGAATCAGG + Intergenic
902772778 1:18655427-18655449 CCCTCCCTGCCAGCTCATCCCGG - Intronic
903173900 1:21569554-21569576 CCCTCCCAGCCCCTGCTTCCTGG - Intronic
903433405 1:23327063-23327085 CCCTCCTAGCCCCCACCTCCAGG + Intronic
904042615 1:27593222-27593244 CCCTCCCCCTCCACTCCTCCAGG + Intronic
904077367 1:27852988-27853010 CCCGGCCAGCCGCCTCATCCGGG + Intergenic
904402055 1:30263444-30263466 TCCTCCCAGGCCACTCAGCCTGG - Intergenic
904965924 1:34372492-34372514 CCCACCAAGCCCACTATTCCAGG - Intergenic
906151708 1:43591513-43591535 CCCTCCCAGCCCCACCATCCAGG + Exonic
906495498 1:46302095-46302117 CCCTCCCCGGCCGTTCATCCCGG + Intronic
906532977 1:46533908-46533930 CCCTCCAACCCCTCTCCTCCAGG + Intergenic
907052008 1:51335982-51336004 CCCTCCCAGCCCCTTCCCCCAGG + Intronic
908801920 1:67889201-67889223 CCCTCCCACCCCACCCTTGCCGG - Intergenic
913052566 1:115130372-115130394 TCTTCCCAGTTCACTCATCCTGG + Intergenic
913320246 1:117582837-117582859 CCATCCCAGCCCTCTGACCCTGG - Intergenic
916165661 1:161965121-161965143 CCCCCCCCGCCCCCTCATCTAGG + Intergenic
916528255 1:165631491-165631513 CGCTCCCAACCCACTCCACCAGG - Intronic
918312046 1:183291970-183291992 CCCGCCCACCCCGCTCTTCCTGG + Intronic
919429475 1:197474740-197474762 CACTCCCAACTCTCTCATCCAGG + Intronic
920215756 1:204360451-204360473 CACTCACACCCCACTCATCCTGG - Intronic
920259920 1:204682263-204682285 CCCTCCCTGCCTCCTCATTCAGG + Intronic
920703580 1:208235751-208235773 CCCTCCCAGCACAATCCTGCAGG - Intronic
921237791 1:213151091-213151113 CCCAGCCAGCCCCCCCATCCGGG - Intronic
921530532 1:216277220-216277242 CTCTCCCAGCCCCCTCCTCTGGG + Intronic
921898807 1:220428709-220428731 CCCTCCCACCTCATTCATCCAGG + Intergenic
922445848 1:225696589-225696611 CTCTCCCACCCCATTGATCCTGG - Intergenic
922745222 1:228039465-228039487 CCCTCCCAACCCCCTTCTCCTGG + Intronic
922822647 1:228494571-228494593 ACCTGCCAGCCCCCTCACCCAGG - Exonic
924253320 1:242157744-242157766 ACCTCCCAGACACCTCATCCAGG - Intronic
1064037594 10:11927152-11927174 CCCTCCGTGTACACTCATCCAGG - Intronic
1064231086 10:13529353-13529375 ACCTCCCCGCCCTCACATCCCGG + Intergenic
1067256525 10:44647595-44647617 CCCACCCATCCCCCTCACCCAGG + Intergenic
1067327057 10:45279402-45279424 CCCTGCCAGCAAATTCATCCCGG - Intergenic
1068735446 10:60408832-60408854 CCCTCCCAAACCCCTCAGCCAGG + Intronic
1069606699 10:69743400-69743422 GCCTCCCAGCCCTCTCCTGCAGG - Intergenic
1069778562 10:70940946-70940968 CCTTCCCTGGCCACTAATCCAGG + Intergenic
1069987690 10:72295620-72295642 CCCTCCCCACCCCCTCACCCTGG - Intergenic
1071519337 10:86319418-86319440 TCATCCCAGCTCACTCAGCCAGG + Intronic
1071569889 10:86691039-86691061 GCCTTACAGCCCACTCACCCTGG - Intronic
1072831661 10:98664342-98664364 CCCTGCCAGCCCACAAACCCAGG - Intronic
1073051133 10:100668102-100668124 TCCTCCCAGCCCCATCACCCTGG - Intergenic
1073268970 10:102245579-102245601 CCGTCCCGGACGACTCATCCTGG + Exonic
1074440747 10:113475483-113475505 CCCTCCCAGCCCTCTCCCTCTGG - Intergenic
1074578929 10:114697466-114697488 CCGGGCCAGCCCACTCAGCCCGG + Intergenic
1074946061 10:118281790-118281812 ACCCCTCAGCACACTCATCCTGG - Intergenic
1076669531 10:132111934-132111956 CCCTGCCTGCCCACATATCCTGG - Intronic
1076692498 10:132230919-132230941 CCCCCACAGCCCACTCACCAGGG + Intronic
1077047611 11:553346-553368 CCATCCCAGCCCCCTTAACCAGG - Intronic
1077154585 11:1085666-1085688 CCCTCCCCGGCCACCCCTCCCGG + Intergenic
1077198486 11:1293394-1293416 CCCTCTCTGCCCACACATCCCGG - Intronic
1077441124 11:2569777-2569799 CCCACCAAGCCCACTGAGCCTGG + Intronic
1077549375 11:3193274-3193296 CCCTCCAAGCCCGGTCATTCAGG + Intergenic
1078136027 11:8652396-8652418 GCCTCCCTGCCCGCTCATCTAGG + Intronic
1078335396 11:10459195-10459217 CCCTCCCACTCCTCTCATCAGGG + Intronic
1080843149 11:36003431-36003453 CCCTCCAAGTCCACTCAGCTTGG - Intronic
1081577498 11:44328335-44328357 CCCTCCCTGCCCCTTCACCCTGG + Intergenic
1082722456 11:56695120-56695142 CCCTCCCATCCCACACACACAGG + Intergenic
1082831724 11:57623361-57623383 CCTTCCCAGCTGAATCATCCTGG - Intergenic
1082989473 11:59195049-59195071 CCCTCCCAGCCCAGTCACCTAGG - Intronic
1083265086 11:61542870-61542892 CACTCGCAGCCCACTCAGACCGG - Intronic
1083635357 11:64117869-64117891 CCCTACCACCACACTCAACCAGG + Exonic
1083636477 11:64123523-64123545 CCCCCCCACCCCACCCATCGAGG - Intronic
1083758876 11:64805198-64805220 CCCTCCCTTCCCCCTCGTCCAGG - Exonic
1083796910 11:65022083-65022105 CCCGCCCAGCCCTCTCTTCTTGG - Exonic
1083932949 11:65855837-65855859 CCCTCCAAACCCACACATCTGGG + Intronic
1083967511 11:66051821-66051843 CCCTTTCAGCCCATTCATCCGGG + Intronic
1083994965 11:66267303-66267325 CCCTCCCTCCCGACTCAACCCGG + Exonic
1084180456 11:67443321-67443343 CCCCCTCAGCCCCCTCAGCCCGG + Intronic
1084214329 11:67639394-67639416 CCCACCCTGCCCACCCACCCTGG + Intronic
1084624259 11:70295400-70295422 CCCGGCCAGCCACCTCATCCGGG - Intronic
1085450633 11:76630049-76630071 CCCTCCCAGCACCCTCCTCCTGG + Intergenic
1088796738 11:113271872-113271894 CCCTCCCAGCCCACGTACTCGGG - Exonic
1089126128 11:116177780-116177802 CCAGCCCAGCCCACTGTTCCTGG - Intergenic
1089578013 11:119460339-119460361 CCCTCCCAGCGCACTCAGGTGGG + Intergenic
1090256413 11:125287639-125287661 CCTCCCCAACCCACTCAGCCGGG - Intronic
1090387357 11:126364773-126364795 CCCTCTCAGCCCACTCATCCAGG + Intronic
1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG + Intronic
1090666496 11:128918207-128918229 CCCTCCCTGCCCAGCCCTCCCGG - Exonic
1091704024 12:2681622-2681644 CCCTCCCCTCCCAGTCCTCCTGG + Intronic
1091710697 12:2738098-2738120 CCCTCCCCTCCCAATCCTCCTGG + Intergenic
1091937606 12:4445897-4445919 CCCGCCCAGCTCACTTATCCAGG + Intergenic
1092255236 12:6923416-6923438 ACCTCCCACCCCAGTCATCTTGG - Exonic
1094817514 12:34202863-34202885 CCACCCCAGCCCACTGTTCCTGG - Intergenic
1096178694 12:49539175-49539197 CCCTCGCCGCCCACAAATCCCGG - Exonic
1096503157 12:52077585-52077607 CCCACCCACCCCCCTCATCTTGG - Intergenic
1096657496 12:53100816-53100838 CCCTCCCAGCCCAATTCTGCGGG + Exonic
1096976331 12:55701031-55701053 CCCCACCATCCAACTCATCCCGG + Exonic
1096996391 12:55840809-55840831 CCCTTCCACCCCACACAGCCCGG - Exonic
1098758014 12:74389578-74389600 CCCTCCAGCCCCACTCCTCCAGG - Intergenic
1100397149 12:94195256-94195278 GCCTCCCACCCCACCCTTCCTGG + Intronic
1101144856 12:101831047-101831069 CCCTCCCAGCCCAGCCCTCAGGG - Intergenic
1102261594 12:111446505-111446527 CCCTCCCAGCCCATTGGACCTGG - Intronic
1102681139 12:114691541-114691563 CCCTCCCAAATCAATCATCCCGG + Intergenic
1103191674 12:119006921-119006943 TCCTCCCAGCCCACACAGCTCGG - Intronic
1103567408 12:121823419-121823441 CCCTCCGAGGCCATTCCTCCGGG + Exonic
1104715530 12:131013620-131013642 CGCTCACAGCCCACACAGCCTGG - Intronic
1104959182 12:132480107-132480129 CCCTCACAGCCCACCCCTCCAGG + Intergenic
1104967559 12:132515334-132515356 CCCACCCAGCACACCCAGCCAGG + Intronic
1106031475 13:26009443-26009465 ACATCCCAGCCCACACATCCAGG + Intronic
1106542915 13:30705863-30705885 CCTTCCCAGCCCTCTCCTCCAGG - Intergenic
1107034580 13:35887225-35887247 ACCTCCCTGCCCACTCAAACAGG - Intronic
1107166001 13:37280782-37280804 CCCGGCCAGCCGCCTCATCCTGG + Intergenic
1108178713 13:47820351-47820373 CCATCCCTGCTCACTCTTCCTGG + Intergenic
1108594397 13:51937437-51937459 CCCTCCCAGCACCCACAGCCTGG + Intronic
1108641434 13:52386022-52386044 ACCTACCAGCACACTCCTCCAGG + Exonic
1108734285 13:53266212-53266234 TCCTTCCACCCCACCCATCCTGG - Intergenic
1111418214 13:87976386-87976408 CCCGGCCAGCCGCCTCATCCGGG - Intergenic
1112498595 13:99925117-99925139 CCCTCCCAGAGCAATCATCTGGG + Intergenic
1113416914 13:110136073-110136095 TCCTCCCATCCTACTCCTCCCGG + Intergenic
1113980336 13:114269389-114269411 ACCTCCCAGCACCCTCACCCTGG - Intronic
1114381371 14:22208084-22208106 GCCTCCCAGCCCAGCCATGCAGG + Intergenic
1114452833 14:22837911-22837933 CCATCTCAACCCACTCAGCCTGG + Intronic
1115473763 14:33794883-33794905 CCCTCCCACCCCCATCATTCTGG + Intronic
1116255444 14:42548635-42548657 TCCTCCCAGCCCTCTGAACCTGG + Intergenic
1117206597 14:53449921-53449943 CCCTCACAGCACACTCCTCATGG - Intergenic
1117627021 14:57650755-57650777 CCATCCCTGCCCACCCCTCCAGG + Intronic
1117997279 14:61489617-61489639 CCTTCCCAGCCTACTCTTCTTGG - Intronic
1118835367 14:69474079-69474101 CCCTCCCCACCCACTCATCAAGG + Intergenic
1119184100 14:72625623-72625645 CCCTCCCAGCCAACACAGCTAGG + Intronic
1119540696 14:75436261-75436283 CCCTCCAAGGCCACTCCTGCAGG + Intronic
1119924367 14:78478688-78478710 GACTCCCAGCCCACTCACCAAGG + Intronic
1120025107 14:79574650-79574672 ACCCCCCAGTCCACTCACCCTGG - Intronic
1121871912 14:97415911-97415933 GCATCCCAGGCCCCTCATCCTGG - Intergenic
1122016853 14:98803584-98803606 GCCTCTCAGCCCACTCTTGCTGG - Intergenic
1122340931 14:101028083-101028105 CCATCTCGGCCCACTCACCCTGG - Intergenic
1123097952 14:105775241-105775263 CACTCCCAGCCCGGTCGTCCTGG + Intergenic
1123499581 15:20867390-20867412 TCCTCCCAGCCCCCTCTTGCAGG - Intergenic
1123556833 15:21441120-21441142 TCCTCCCAGCCCCCTCTTGCAGG - Intergenic
1123593056 15:21878356-21878378 TCCTCCCAGCCCCCTCTTGCAGG - Intergenic
1124389555 15:29241934-29241956 TCCTCCCACCTCACTCTTCCAGG - Intronic
1124594272 15:31080694-31080716 CCCTCTCAGCCCGGTCCTCCAGG + Intronic
1125597841 15:40899046-40899068 CCCTCAGAGCCCACCCACCCAGG - Intronic
1125751691 15:42033576-42033598 CCCTCCCACCCCACCCACCCAGG - Intronic
1126101047 15:45118375-45118397 CCTTCCCACCCCACTCAGCTGGG - Exonic
1126675529 15:51156785-51156807 CCCTCCCTGCCCCCTCCTCCAGG - Intergenic
1128506809 15:68278303-68278325 CCCTCACAGCCCATTCAACAGGG - Exonic
1128880492 15:71237770-71237792 CCCTCCCTACACACTCACCCTGG - Intronic
1129727615 15:77909544-77909566 CCTCCCCAGCCCACACATGCTGG - Intergenic
1130094269 15:80844392-80844414 CCCCTCCTGCCCCCTCATCCTGG - Intronic
1131535279 15:93232279-93232301 CTCTCCCAGCACAATCATCCAGG + Intergenic
1132275430 15:100559198-100559220 CCCTCCCTGCCCCCACAGCCTGG - Intergenic
1132279701 15:100602494-100602516 CCCTCCACCCCCACCCATCCCGG + Intronic
1132336216 15:101050233-101050255 CCCTGCCACCCCACCCATCCCGG + Intronic
1202965176 15_KI270727v1_random:168309-168331 TCCTCCCAGCCCCCTCTTGCAGG - Intergenic
1132546205 16:534526-534548 CCCTCCCACCCGACTCATGCAGG + Intronic
1132547225 16:538877-538899 CCCCCCCAGCCCGCTCACCTAGG + Intronic
1133340305 16:5031683-5031705 TCCGCCCAGCCCACTGGTCCTGG + Intronic
1134516572 16:14892385-14892407 CCCTAGCAGACAACTCATCCGGG + Intronic
1134704242 16:16291041-16291063 CCCTAGCAGACAACTCATCCGGG + Intronic
1134963301 16:18421073-18421095 CCCTAGCAGACAACTCATCCGGG - Intronic
1134967596 16:18503672-18503694 CCCTAGCAGACAACTCATCCGGG - Intronic
1135056930 16:19239752-19239774 CCCACTGGGCCCACTCATCCTGG + Intronic
1135639540 16:24108952-24108974 CCCGGCCAGCCCCCCCATCCGGG - Intronic
1137677102 16:50309171-50309193 CTCTCCCAGACCCCGCATCCTGG + Intronic
1138551091 16:57748893-57748915 CGCTCCCAGCCCACTCAGCTTGG - Intronic
1138654912 16:58485590-58485612 CTCTCCCAGCCCCCACACCCTGG + Intronic
1138961819 16:62036735-62036757 ATCTGCCAGCCCACTTATCCAGG - Exonic
1139374449 16:66488016-66488038 CCTTCCCTGCCCTCTCATGCTGG - Intronic
1140994468 16:80244203-80244225 CCCGGCCAGCCCCCCCATCCGGG + Intergenic
1141600004 16:85119961-85119983 CCCTCCCAGCCCTGACACCCTGG + Intergenic
1141886056 16:86893069-86893091 CCCTCCCAGCCCCCTGACCCAGG - Intergenic
1142068141 16:88074410-88074432 CCCTCCCAACCCACTGCTCCAGG - Intronic
1142358135 16:89613715-89613737 ACTCCCCAGCCCACTCACCCTGG - Intronic
1142627967 17:1204035-1204057 CCAGCCCAGTCCACTCCTCCCGG + Intronic
1142634233 17:1247123-1247145 CCCGGCCAGCCCCCCCATCCGGG - Intergenic
1142704960 17:1689175-1689197 CCCGGCCAGCCCCCCCATCCGGG - Intergenic
1142709823 17:1716895-1716917 CTCGCCCAGCCCACTCCTCCTGG + Intronic
1143150895 17:4807221-4807243 CCTTCCCGGCCCCCTCACCCTGG - Exonic
1143446438 17:7012806-7012828 GCCTCCCAGCCCTCCCAGCCCGG - Intronic
1143655173 17:8289630-8289652 CCCTCCCAGCCCGATTCTCCTGG - Exonic
1143762784 17:9117003-9117025 CTCTCCCACCCCCCTCATTCAGG - Intronic
1143890764 17:10100641-10100663 ACCTCCCAACCCCCCCATCCAGG + Intronic
1144727870 17:17510937-17510959 CCCTCACCGCCCTCACATCCTGG + Intronic
1145418171 17:22741438-22741460 CCCCGCCAGCCGCCTCATCCGGG + Intergenic
1145923152 17:28626562-28626584 CCCACCCAACCCACACTTCCTGG + Intronic
1146944859 17:36866731-36866753 CCCTCCCAGCTCACCCTCCCTGG - Intergenic
1146945422 17:36870036-36870058 CCCTCCCAGCTCACCCTCCCTGG - Intergenic
1147609781 17:41794632-41794654 CCTTCCCAGCCTCCTCCTCCAGG + Intergenic
1147648890 17:42050745-42050767 CCCGCCCAGCGCGCTCAGCCCGG + Intronic
1147654358 17:42080429-42080451 CCATCCCAGCCCACTGATTCAGG + Intergenic
1147952290 17:44113957-44113979 CCCTTCGAGCCCAGTCATGCTGG + Intronic
1148080341 17:44964514-44964536 CCCTCCCAGCCAACACATTTGGG + Intronic
1148192394 17:45688693-45688715 CCCTCCCTCCCAACTCAGCCTGG - Intergenic
1148677272 17:49452610-49452632 CCCTCCCACCCCATTCATTCTGG - Intronic
1150289504 17:63973287-63973309 CCCAACCAGGCCCCTCATCCTGG - Intergenic
1151353109 17:73543179-73543201 AGCTCCCTGCCCTCTCATCCAGG + Intronic
1151508547 17:74544380-74544402 CCCTCCCAACACACACATGCAGG + Intronic
1151542682 17:74772729-74772751 CCCACCTAGCCCCCTCAGCCTGG - Intronic
1151975086 17:77480053-77480075 CCCACCCAGGCCACGCAGCCTGG - Intronic
1152289027 17:79428377-79428399 CCCGCCCAGCCTTCGCATCCAGG + Intronic
1152358089 17:79816133-79816155 CCAGACCAGCCCACTCCTCCTGG + Intergenic
1152699579 17:81812334-81812356 CCCTCCCAGCGCTCTCAGACAGG - Intronic
1152794058 17:82298267-82298289 CCCTCCCAGCCCACAACTTCCGG - Intergenic
1153139222 18:1953655-1953677 CCCACTGAGCCCACTCATCCTGG + Intergenic
1153453809 18:5259177-5259199 CCCTCCTAGCCCACTGTTTCTGG - Intergenic
1155956705 18:31960932-31960954 CCCGGCCAGCCACCTCATCCGGG + Intergenic
1156259923 18:35436779-35436801 CCCTCCCAGCCCCCACTCCCCGG - Intergenic
1156432609 18:37092140-37092162 CCCACCCAGCCCACTGCTGCTGG + Intronic
1156733933 18:40229760-40229782 CACTCCCTCCCCACTCTTCCTGG + Intergenic
1156939279 18:42745244-42745266 ACCTCCCAGCTCACTCATGTTGG + Intronic
1157101142 18:44731054-44731076 CCATCCCAGCCCAGTCACCAGGG - Intronic
1157598864 18:48880525-48880547 CCCTTCCAGCCCCAGCATCCAGG - Intergenic
1157801790 18:50627049-50627071 CGCCCCCCGCCCACTCATCTTGG + Intronic
1158652007 18:59296686-59296708 CCCTCCCACCCCTCACATCACGG + Exonic
1158905929 18:62011696-62011718 ACCTTCCAGCACACTCTTCCTGG - Intergenic
1159859581 18:73631517-73631539 CTCCCCCACCCCACTCAACCTGG - Intergenic
1160330777 18:77989822-77989844 CCCTCCAAGCCCACGCAGCTCGG + Intergenic
1160748652 19:723277-723299 CACCCCCAGCCCTCTCAGCCTGG - Intronic
1161085783 19:2334267-2334289 CCCACCGTGCCCACTGATCCTGG + Intronic
1161207864 19:3051215-3051237 CACTCCCAGCCCTCTCCTCAGGG + Intergenic
1161470801 19:4456040-4456062 CCCACCCACCCCACACACCCTGG + Intronic
1161583984 19:5095221-5095243 AACTCCCAGCCCCCTGATCCAGG - Intronic
1161766539 19:6211788-6211810 CCTTCCCGGCCCACTCTTCCAGG - Intergenic
1161792960 19:6371808-6371830 CCCTCCCTGCCCCCACAGCCTGG + Intergenic
1162421076 19:10566307-10566329 CCCACCCAGCTCACTCACCCTGG + Intergenic
1163190014 19:15670697-15670719 CCCTGCCAGCTCAATCAGCCAGG - Intergenic
1163297912 19:16424320-16424342 CCCTCCCACCCCACCCCACCAGG + Intronic
1163598007 19:18231657-18231679 CCATCCAAGGCCACTCAGCCTGG + Intronic
1164450381 19:28357146-28357168 CTCTGCCAGCCCTGTCATCCTGG - Intergenic
1164590073 19:29501899-29501921 CCCTCCGACCCCACTCATGGGGG - Intergenic
1164677579 19:30111993-30112015 GACTACCAGCCCACTCACCCAGG - Intergenic
1164678602 19:30119375-30119397 CACTGCCAGCCCACTCATGGTGG - Intergenic
1164989903 19:32675813-32675835 CCCGCCCACCCCGCTCGTCCCGG - Exonic
1165369552 19:35396031-35396053 CCCTCCCAGCACAAGCAGCCTGG - Intergenic
1165949995 19:39469000-39469022 CCCACTCAGCCCACTCAGCTGGG + Intronic
1166391215 19:42409874-42409896 CCCTCCCACCCCACATCTCCAGG - Intronic
1166425715 19:42676441-42676463 CCCTGCCAGCCGCCCCATCCGGG - Intronic
1166595999 19:44051056-44051078 CCCTCCCAACCCATTCTACCTGG + Intergenic
1167521532 19:49958750-49958772 CCCTCCCAGCCCTCAGACCCCGG - Exonic
1167523845 19:49971972-49971994 CCCTCCCAGCCCTCAGACCCTGG + Intergenic
1167622916 19:50568786-50568808 CCCTCCCCTCCCCTTCATCCAGG - Intergenic
1167651084 19:50729336-50729358 CCATCCTAGCCCAATCATCAGGG + Intergenic
1167756221 19:51415288-51415310 CCCTCCCAGCCCTCAGACCCCGG - Exonic
1167805384 19:51779968-51779990 CCCCCTCAGATCACTCATCCTGG - Intronic
1167876117 19:52414154-52414176 CGCTGCCAGCCGACTCATCCAGG + Intronic
1168311968 19:55464998-55465020 CCCTCCCAGCCCCCTCCCCACGG - Intergenic
926215319 2:10902598-10902620 CCCGGCCAGCCCCCCCATCCGGG - Intergenic
927178059 2:20424251-20424273 CCCTGCCTGCCCCCTCATGCTGG - Intergenic
929535846 2:42783709-42783731 TCCGCCCTGTCCACTCATCCTGG - Intronic
929946355 2:46375535-46375557 CCCTCCCAGGTCACTCTCCCTGG + Intronic
932624755 2:73288561-73288583 TCTTCCCACCCCACACATCCAGG - Intergenic
932807448 2:74796012-74796034 CCCAGCCAGCCGCCTCATCCGGG - Intergenic
933939909 2:87236448-87236470 CCCTCCCAGCCCCCTGTTCCAGG + Intergenic
934529266 2:95075044-95075066 CCCTCCCAGCAGAGCCATCCTGG - Intergenic
934780385 2:96966143-96966165 CCCCACCAGCCCCCTCCTCCAGG + Intronic
934887668 2:98039129-98039151 CCCTCACCGCCCACCCAACCAGG + Intergenic
936746562 2:115583483-115583505 GGCTCCCAGCCATCTCATCCAGG - Intronic
937298836 2:120826118-120826140 CCCTCCCACCCCACCCAGCCGGG - Intronic
937306406 2:120874162-120874184 CCCTCCCAGCCAACAGAGCCCGG + Intronic
937883699 2:126886371-126886393 CCCTCCCAGCCCCCTAACCCCGG + Intergenic
937990345 2:127658752-127658774 CCCTCTCTGCCCAGTCTTCCAGG - Intronic
938116170 2:128604198-128604220 CCCTCACAGCCCAGGCACCCAGG + Intergenic
938473912 2:131590455-131590477 TCCTCCAAGCCCCCTCATGCCGG + Intergenic
941476186 2:165953916-165953938 CCCTCGCAGCCCTCACCTCCGGG - Intergenic
941769024 2:169327676-169327698 CCCGGCCAGCCGACCCATCCGGG + Intronic
942415296 2:175752255-175752277 CACTCCCAGCCCCTTCATCATGG - Intergenic
943028123 2:182653754-182653776 CACTAGTAGCCCACTCATCCTGG + Intergenic
945978956 2:216293227-216293249 CCTTCCCAGCCAGCTCATGCTGG + Intronic
948161413 2:235827891-235827913 CCCTCGCAGCCCAGCCCTCCGGG - Intronic
948209152 2:236179531-236179553 CCCTCCCGCCCCACCCCTCCCGG + Intergenic
948542325 2:238699524-238699546 CCCTCACCGCCCACTCATTTGGG - Intergenic
948884294 2:240875198-240875220 CCCTGCCAGGCCTCACATCCTGG - Exonic
1168960036 20:1862621-1862643 CCCTCCCAAGCCAATCATCCAGG + Intergenic
1169130862 20:3165853-3165875 CTCCCCCAGTGCACTCATCCAGG - Exonic
1169468292 20:5860763-5860785 CCCTCCCCTTCCACCCATCCTGG + Intronic
1170743441 20:19077920-19077942 CCCTCCCTGCCCCCTCAGCCTGG - Intergenic
1170756976 20:19213085-19213107 CCAACCCAGCCCGCTTATCCTGG - Intronic
1170898768 20:20439608-20439630 CCTCCCCAGCCCACTCCCCCAGG - Intronic
1171812485 20:29756735-29756757 CCATCCCATCCGGCTCATCCGGG + Intergenic
1172425260 20:34851546-34851568 CCCATCCACCCCACCCATCCAGG - Intronic
1172944155 20:38674811-38674833 GACTCCCAGCCCAGTCTTCCCGG + Intergenic
1174863728 20:54115653-54115675 CCCTTCAAACTCACTCATCCTGG + Intergenic
1175097511 20:56553150-56553172 CCCACCCTGCCCATTCAGCCTGG + Intergenic
1175206815 20:57317510-57317532 CCCTGCCATCCCAGTGATCCAGG - Intergenic
1175769299 20:61613290-61613312 GCCTCCCAGCTCACTCTGCCTGG - Intronic
1175931658 20:62496485-62496507 CCCTCCCAACCCACCCAGCAGGG - Intergenic
1176234460 20:64047985-64048007 ACCTCCCAGGCCACCCTTCCTGG - Exonic
1176269901 20:64230871-64230893 CCTTCCCAGCCAACTCGGCCAGG - Intronic
1179605433 21:42513083-42513105 GGCTCCCAGCCCACTCCTCGGGG - Intronic
1179986278 21:44922193-44922215 CCCTCCCAACCCAGTCCTCTAGG - Intronic
1180031436 21:45211124-45211146 CCCTTCCAGCCCACTCCCCAGGG - Intronic
1180042380 21:45287300-45287322 CCATCCCATCCCACCCCTCCTGG + Intronic
1180083481 21:45497259-45497281 CCCTCCCAGCACAGCCGTCCAGG + Intronic
1181595675 22:23913098-23913120 CCATTCCAGACCCCTCATCCAGG + Intergenic
1182321175 22:29479461-29479483 CCCCCCAACCCCACCCATCCGGG + Intergenic
1182642623 22:31780618-31780640 CCTTCCCAAGCCACTCATCCAGG + Intronic
1183084538 22:35478447-35478469 CACTCCCAGCCATCTAATCCGGG - Intergenic
1183333306 22:37232713-37232735 CCCTTCCAGCCAGCTCAGCCTGG - Intronic
1183506210 22:38210328-38210350 TCCTCCCAGCCCACACAGTCAGG - Intronic
1183628324 22:39018182-39018204 CCCTCCCAGCCCAGGTATCCAGG - Intronic
1183702953 22:39460095-39460117 CCCGCCCAGCCAAGTCATTCAGG + Intronic
1183735564 22:39643001-39643023 CCCTTCCTGCTCCCTCATCCCGG - Intronic
1183977166 22:41519025-41519047 CCCTCCCCACCCACTGCTCCAGG - Intronic
1184078879 22:42203742-42203764 CCCTCCCAGCCCCCTCTCTCTGG - Intronic
1185330308 22:50249281-50249303 CCCACCCAGCCCCCTCCCCCTGG - Intronic
1185371474 22:50462822-50462844 CCTTCCCAGCCCCCCCTTCCTGG - Intronic
949853513 3:8440364-8440386 CCCTGCCAGCCGCCCCATCCGGG + Intergenic
950198440 3:11026133-11026155 CATTCCCAGCCCCCTCCTCCGGG + Intronic
950794082 3:15496399-15496421 CCCTCCCAGTCAACTAAGCCAGG + Intronic
951027987 3:17849692-17849714 CCCTGCCATGACACTCATCCAGG - Intronic
951080167 3:18444142-18444164 CTCCCGCAGCCCACTCCTCCAGG + Intronic
952755041 3:36858514-36858536 CCCTCCCTGACCACTCACCATGG + Intronic
953793843 3:45967947-45967969 CCTTCCCAGACAACTCCTCCTGG + Exonic
954316246 3:49803315-49803337 CCCTCCCAGCCCTCTCCGCGCGG + Exonic
954413369 3:50380923-50380945 ATCTACCAGCCCACCCATCCTGG - Intronic
954435646 3:50494462-50494484 CCCTCCAAGCCCACACTGCCTGG + Intronic
955826984 3:62957865-62957887 CCCACTCAGCCAACTCATCATGG - Intergenic
956839559 3:73125095-73125117 TCCTCCAAGCCGACTAATCCAGG + Intergenic
956869645 3:73404170-73404192 CTCTCCCAGCCCACCCGTGCTGG - Exonic
958957254 3:100477606-100477628 CCCGGCCAGCCGCCTCATCCGGG - Intergenic
960960605 3:123067709-123067731 CCCACCCAGCCCACCGAGCCTGG - Intronic
961034834 3:123635018-123635040 CCCACCCAGCCCAGCCATCAGGG - Intronic
962188946 3:133290037-133290059 TCCTCCCAGCAGACTCATCGGGG - Intronic
962406424 3:135104309-135104331 CTTTCCCAGCCCACTCATTACGG - Intronic
965455696 3:168897110-168897132 CCATCTCAGACCACTCAGCCTGG + Intergenic
967054888 3:185823610-185823632 CCCTCCCTGCCCTCTCCTCCCGG + Intronic
967948988 3:194825665-194825687 CCCACCCTGCCCACTCACTCTGG - Intergenic
968417345 4:451796-451818 ACCTCCCAGCCCAGTCCTCGTGG - Intronic
969523788 4:7693869-7693891 CCCACCCAGGCCCCTCAGCCAGG - Intronic
970436834 4:16043826-16043848 CACTCCCAGGCCACACACCCTGG - Intronic
971418834 4:26457204-26457226 CCCTCCCACCCAACTCTTGCAGG + Intergenic
972396606 4:38663959-38663981 CCCGCCCCGCCCAGTCACCCGGG - Intergenic
976265121 4:83182400-83182422 CCCTGCCAGCCGCCCCATCCGGG + Intergenic
976687254 4:87828075-87828097 GACTCCCAGCACACTCATTCTGG + Intronic
978620741 4:110632718-110632740 GCCCCCCAGCCTACTCCTCCCGG - Intronic
979753312 4:124306592-124306614 CCCTCCCTTCCCACTCTGCCAGG - Intergenic
981044490 4:140252912-140252934 CCTCCCCAGCTCACCCATCCCGG - Intergenic
981136896 4:141220816-141220838 CCTTCCCCGCCCACTCCTGCGGG - Intergenic
981616984 4:146652675-146652697 CCCCCCCAGCACACTCTTGCAGG + Intergenic
982034648 4:151333824-151333846 CCCTCCCAGCACATTGATCTTGG - Intergenic
982053511 4:151526456-151526478 CCCGGCCAGCCGCCTCATCCGGG - Intronic
986288357 5:6378021-6378043 CCCTCCCAGCCTTTTCCTCCTGG - Intronic
989075758 5:37563146-37563168 CCCAGCCAGCCCCCCCATCCGGG - Intronic
991592114 5:68264167-68264189 CCTTGCCAGCTCACTCAGCCAGG - Intronic
991912120 5:71572469-71572491 CGCTGCCAGCAGACTCATCCCGG - Intergenic
992443200 5:76812934-76812956 CCCAGCCAGCCCCCTCGTCCCGG + Intergenic
994175103 5:96702701-96702723 ACCTCCCTCCCCACGCATCCCGG + Intronic
995809134 5:116085197-116085219 CCACCCCACCCCACTCAACCGGG - Intronic
996428556 5:123343438-123343460 CCCTCGCAGCCCTCACATTCTGG + Intergenic
996684547 5:126266192-126266214 CTCACCCTGCCCACTCAGCCTGG - Intergenic
997438518 5:133892322-133892344 CCATCTCAGCCCACTGATCAGGG - Intergenic
998162601 5:139822033-139822055 CCCTCCCCACCCACTCAGCCAGG + Intronic
998216642 5:140242739-140242761 CCGCCCCATCCCACTCAGCCAGG + Intronic
998518171 5:142774739-142774761 CCCTCCCTCCCCACTAACCCCGG + Intronic
1000339642 5:160267087-160267109 CCCTCCCAGAGCTCACATCCTGG - Intronic
1001496229 5:172188949-172188971 TTCTCCCAGCCCTCTAATCCTGG - Intergenic
1002279008 5:178120152-178120174 CCCTCTCTGCCCTCTCTTCCTGG + Intronic
1002443170 5:179274765-179274787 GCCTCCCGGCGCACTCAGCCTGG + Intronic
1002542211 5:179913765-179913787 CCAACCCAGCCCTCTCAGCCAGG + Intronic
1002543311 5:179920747-179920769 GCCCCCCAGCCCTCTCATCTGGG + Intronic
1002618568 5:180470381-180470403 CCTCCCCACCCCACACATCCTGG + Intergenic
1002779029 6:352523-352545 CCCTCCCTGCCCACTGATTTGGG - Intergenic
1002897458 6:1388068-1388090 CCCCACCAGCACACTCAGCCAGG + Intergenic
1003034754 6:2632957-2632979 CCCTCCCAGCTCCTTCCTCCCGG + Intronic
1003058042 6:2840904-2840926 CCCTCCCACCCCACTAAAGCTGG - Intronic
1005841055 6:29744832-29744854 GCCTCCCAGCCTGCCCATCCTGG - Intergenic
1006059817 6:31411652-31411674 GCCTCCCAGCCTGCCCATCCTGG + Intronic
1006230446 6:32581695-32581717 CCATCCCAGCCTTCTCTTCCTGG + Exonic
1006313542 6:33277626-33277648 CCCTCCCTTCCTGCTCATCCTGG + Exonic
1006860952 6:37171056-37171078 CTCACCCCACCCACTCATCCTGG - Intronic
1007069144 6:39022460-39022482 CCTTCTCAGCCCACTCAATCAGG + Intronic
1007119743 6:39369988-39370010 CTCTCCCAGCCTACCCCTCCAGG + Intronic
1007180117 6:39923565-39923587 CAGGCCCAGCCCCCTCATCCAGG - Intronic
1007327644 6:41073790-41073812 TCCTCCCAGCCCGCTCCGCCCGG + Intronic
1007422630 6:41728761-41728783 CCCTCCCCGCACAGTGATCCAGG - Intronic
1007503031 6:42313132-42313154 TCCTTCCAGCCCACACTTCCAGG + Intronic
1007696882 6:43739834-43739856 CCGTCCCAGCCCACTCCACAGGG - Intergenic
1008595152 6:53034881-53034903 CCCTCCCAGCAAGCTCATCCAGG - Intronic
1008598608 6:53066332-53066354 CCCTCCAACCCCACTCCGCCAGG - Intronic
1010809926 6:80289722-80289744 CCCTGTCAGCTCACACATCCAGG - Intronic
1011352240 6:86435320-86435342 CCTTCTCAGCCCACTCAATCAGG + Intergenic
1011648011 6:89478621-89478643 CCCTCCCCGCCTCCTCACCCCGG - Intronic
1013376258 6:109517954-109517976 CCCACCCAGGACTCTCATCCTGG - Intronic
1013499305 6:110732059-110732081 CCCTCCCATCCCACCCACCTTGG + Intronic
1016923419 6:149317760-149317782 CCCTCCCCTCCCCCTCAGCCAGG + Intronic
1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG + Intergenic
1016993965 6:149947911-149947933 TTCTCCCAGCCCCCTCCTCCTGG - Intronic
1016997479 6:149970588-149970610 CCCTCACAGCTCCCTCGTCCTGG - Intronic
1017001322 6:149999588-149999610 CCCTCACAGCTCCCTCATCCTGG + Intergenic
1017004368 6:150019626-150019648 CTCTCCCAGCCCCCTCCTCCTGG + Intronic
1017011038 6:150064107-150064129 CCCTCACAGCCCCCTCGTCCTGG + Intronic
1017044430 6:150334072-150334094 CCCTCCCTGCACACTCTCCCTGG + Intergenic
1018066907 6:160131027-160131049 CCCTATCAGCCTCCTCATCCTGG - Intronic
1018457469 6:163964650-163964672 TCCTCACAGCCCCCTCAACCGGG + Intergenic
1018528107 6:164736148-164736170 CCCGGCCAGCCGCCTCATCCGGG - Intergenic
1018706404 6:166466573-166466595 CCCTCCCAGCCCAGCAATCCTGG + Intronic
1019104384 6:169656653-169656675 CCATCCCAGCCTCCTCCTCCTGG - Intronic
1019154041 6:170026872-170026894 CCATCCCTGCCCTCTCAGCCAGG + Intergenic
1019352736 7:562536-562558 CCCTTCCAGCCCTCTCCACCAGG + Intronic
1019613129 7:1946943-1946965 CCCACCCAGCCTCCTCCTCCAGG - Intronic
1019656715 7:2199919-2199941 CTCTCCCATCCCTTTCATCCAGG - Intronic
1020007184 7:4789173-4789195 CCGTCCCATCCCCTTCATCCCGG + Intronic
1020007201 7:4789216-4789238 CCGTCCCATCCCCTTCATCCCGG + Intronic
1020273038 7:6608090-6608112 CCCGCCCTGCCCACGCATCCCGG + Exonic
1021143968 7:17062645-17062667 CACTCTCTACCCACTCATCCAGG + Intergenic
1021196366 7:17678846-17678868 CACCCACAGCCCCCTCATCCCGG - Intergenic
1022089105 7:27096312-27096334 GCCTCCCAGCCCCCACCTCCCGG - Intergenic
1022099402 7:27160466-27160488 TCCTCCCAGCCAACTCGGCCCGG + Intergenic
1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG + Intronic
1026580946 7:71616089-71616111 CCCTCCCATCCCACCCAACTGGG - Intronic
1026868454 7:73836549-73836571 CCCGGCCAGCCCCCCCATCCGGG + Intronic
1026868512 7:73836677-73836699 CCCGGCCAGCCCCCCCATCCGGG + Intronic
1027233977 7:76287089-76287111 TGCTCCCAGCCCCCTCCTCCTGG + Exonic
1027652379 7:80885328-80885350 GCCACCAAGCCCAGTCATCCAGG - Intronic
1027833640 7:83213883-83213905 ACCTCCCACCCCACTCGTTCTGG - Intergenic
1029712583 7:102307721-102307743 CCCTCCCAGCTCTGTCATCCTGG + Intronic
1029746098 7:102516611-102516633 CCCTCCCACCCTCCTCCTCCAGG + Intronic
1029764036 7:102615590-102615612 CCCTCCCACCCTCCTCCTCCAGG + Intronic
1031965012 7:128021472-128021494 CTTTACCTGCCCACTCATCCAGG - Intronic
1031971295 7:128066904-128066926 TCTTCCCAACCCACTCATCCTGG - Intronic
1032018175 7:128392763-128392785 CCCTCCGAGCCCAGCCAGCCAGG - Exonic
1032196799 7:129794096-129794118 CCCTCACAGCCCATTCAGCAGGG + Intergenic
1034522597 7:151632243-151632265 CCCTGCCAGGCCCCTCCTCCCGG - Intronic
1035529890 8:342865-342887 GCCTCCAATCCCACTCATCGGGG + Intergenic
1035608879 8:947680-947702 CCCTCCCTGCCCACGGCTCCGGG + Intergenic
1036155266 8:6336268-6336290 CCCTCCCTCCCCACTAAGCCCGG + Intergenic
1038373414 8:27014298-27014320 CATACCCAGCCCACTCAACCAGG - Intergenic
1041552738 8:59119444-59119466 CCCCCCCACCCCCCACATCCCGG - Intergenic
1042786173 8:72549517-72549539 TACTCCCAGCCCCCTCATCTAGG - Intronic
1045524896 8:102933259-102933281 CCCTCACGTCCCAGTCATCCTGG - Intronic
1046780540 8:118210086-118210108 CCATCCCAGCCCATTTCTCCTGG - Intronic
1047166176 8:122440920-122440942 CCCTCCCAGCAGACTTATCAAGG + Intergenic
1047267086 8:123315978-123316000 CCCGGCCAGCCCCCCCATCCGGG + Intergenic
1047297541 8:123584504-123584526 CACTCCCAACCCTCTCCTCCTGG + Intergenic
1049795043 8:144493365-144493387 CCTGCCCAGCCCCCTCAGCCTGG + Intronic
1052258862 9:26491514-26491536 CCCTCCCAGTCCACTGTCCCTGG + Intergenic
1052466018 9:28830307-28830329 GGCCCCCACCCCACTCATCCAGG - Intergenic
1056815166 9:89795922-89795944 CCCTCCCAGGCTAGGCATCCAGG + Intergenic
1060294571 9:122334514-122334536 CAGTCCCAGCCCACCCATCCAGG + Intergenic
1060526968 9:124326276-124326298 ACCTCCAAGCCCGCTCACCCGGG + Intronic
1060734662 9:126059327-126059349 CCCTCCCAGCCTCCACATGCAGG + Intergenic
1061028885 9:128068027-128068049 CCCGCCCACCCCATTGATCCGGG + Intronic
1061076214 9:128343051-128343073 ACCTCCCAGCCCAGACAGCCAGG - Intronic
1061817521 9:133205816-133205838 CCCTCCCATCCCACACAGCCAGG - Intronic
1061848516 9:133401520-133401542 CCCGGCCAGGCCACGCATCCTGG - Intronic
1062082327 9:134630600-134630622 CCCTCCCAGCCCATTCCTCCAGG - Intergenic
1062242884 9:135549410-135549432 CCTTCCCATCCCACACAGCCAGG + Intronic
1062378420 9:136275305-136275327 CCCTCCCAGCACCCCCAGCCGGG - Intergenic
1062429659 9:136521350-136521372 CCCTCCCTGCCCACTCCCCAGGG + Intronic
1062442787 9:136578660-136578682 CCCTCCCATCCCACTCCCCGGGG + Intergenic
1062535050 9:137017744-137017766 CCCTGCCAGCCCGCGCCTCCAGG + Intronic
1062544190 9:137054297-137054319 CCCTTCCCGCCCACTCAGCAAGG + Intergenic
1062550369 9:137083306-137083328 GCATCCCAGCCCACACACCCTGG + Exonic
1186329800 X:8519731-8519753 GCCTCCCAGCCCAAGGATCCTGG + Intergenic
1189298753 X:39937300-39937322 CCCTCCCAGTCTATGCATCCTGG + Intergenic
1189504303 X:41595528-41595550 CAATCACAGCTCACTCATCCTGG - Intronic
1190769701 X:53504415-53504437 CCCAGCCAGCCACCTCATCCGGG + Intergenic
1190820485 X:53967460-53967482 CCCGGCCAGCCACCTCATCCGGG + Intronic
1191894196 X:65975353-65975375 CCCGGCCAGCCAACCCATCCGGG - Intergenic
1193163616 X:78257356-78257378 CCCTCCCAGTCCACTGTTTCTGG + Intergenic
1194421208 X:93674477-93674499 CCCTCCCATCCCACTGTTCTTGG - Intronic
1197722550 X:129755148-129755170 CTCTCCCAGCCCTCACCTCCTGG - Intronic
1198301344 X:135336642-135336664 TACTCCTAGCCCACTTATCCGGG + Intronic
1199527210 X:148805942-148805964 CCCTCTCCGCCCCCTCCTCCTGG - Intronic
1199721225 X:150543914-150543936 CCATCCCTGCCCACGCCTCCAGG - Intergenic
1199959233 X:152766720-152766742 CTCTCAAAGCCCACTCATGCAGG + Exonic
1200092166 X:153641126-153641148 CCCTCCCAGCTCACGCACCATGG + Intergenic
1200108871 X:153728926-153728948 CCCTGCCAGCCCCCTCCTCCTGG - Intronic