ID: 1090389956

View in Genome Browser
Species Human (GRCh38)
Location 11:126382128-126382150
Sequence TGTTCTCTTTGGGGCACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 2, 1: 0, 2: 2, 3: 19, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090389950_1090389956 10 Left 1090389950 11:126382095-126382117 CCCTGCAGCTGTCCAAATAGAGC 0: 2
1: 0
2: 0
3: 8
4: 153
Right 1090389956 11:126382128-126382150 TGTTCTCTTTGGGGCACAGCTGG 0: 2
1: 0
2: 2
3: 19
4: 213
1090389951_1090389956 9 Left 1090389951 11:126382096-126382118 CCTGCAGCTGTCCAAATAGAGCA 0: 2
1: 0
2: 1
3: 8
4: 182
Right 1090389956 11:126382128-126382150 TGTTCTCTTTGGGGCACAGCTGG 0: 2
1: 0
2: 2
3: 19
4: 213
1090389949_1090389956 25 Left 1090389949 11:126382080-126382102 CCTGAGCATCGCTGACCCTGCAG 0: 2
1: 0
2: 2
3: 11
4: 166
Right 1090389956 11:126382128-126382150 TGTTCTCTTTGGGGCACAGCTGG 0: 2
1: 0
2: 2
3: 19
4: 213
1090389952_1090389956 -2 Left 1090389952 11:126382107-126382129 CCAAATAGAGCAAGAAGCGAATG 0: 1
1: 1
2: 0
3: 16
4: 136
Right 1090389956 11:126382128-126382150 TGTTCTCTTTGGGGCACAGCTGG 0: 2
1: 0
2: 2
3: 19
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090389956 Original CRISPR TGTTCTCTTTGGGGCACAGC TGG Intronic
900323694 1:2097121-2097143 GGTTGTCTTGGGGCCACAGCTGG + Intronic
900746255 1:4362651-4362673 TCTCCTCTCTGGGGCAGAGCAGG + Intergenic
903467131 1:23559441-23559463 CTTTCTCTTTGGGGCACCTCTGG - Exonic
904465606 1:30705490-30705512 GGTGCTCTTTGGGGCACCTCTGG - Intergenic
905920742 1:41717022-41717044 TCTTCTCTTTTGGGGAGAGCTGG + Intronic
906744061 1:48209178-48209200 TGTTCTCTTGCGGGCAGAGTGGG + Intergenic
912857027 1:113178321-113178343 TGTTGTCATGGGTGCACAGCTGG - Intergenic
913396161 1:118375158-118375180 TGGTCCCTTTTAGGCACAGCTGG - Intergenic
917160705 1:172054307-172054329 TGTTGTCTCTGGGGCACTGGAGG + Intronic
917674474 1:177305708-177305730 TGTTTTATTTGGGGCGCAGGAGG + Intergenic
920785322 1:209035277-209035299 GGGTCCCTTTGGGCCACAGCTGG + Intergenic
923172419 1:231429864-231429886 TGTCCTCTTTTAGCCACAGCTGG + Intergenic
924256509 1:242188567-242188589 TGTACACTGTGGGCCACAGCTGG + Intronic
1062861933 10:816975-816997 TGGTAACTCTGGGGCACAGCTGG + Intronic
1063152874 10:3352735-3352757 CGTTTTCTTTGGGGCAGAGAGGG - Intergenic
1064314871 10:14245944-14245966 TGTCCTCTTTCAGGCACAGCCGG - Intronic
1065425383 10:25597924-25597946 TGTCCTCTTTAGAGCACTGCCGG - Exonic
1067429786 10:46235481-46235503 TGTTCTCTTGGGGGCTTAGCAGG + Intergenic
1067448343 10:46366743-46366765 TGCCCTCTGTGGGGCACAGATGG + Intergenic
1067589034 10:47494023-47494045 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1067636159 10:48002114-48002136 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1067913712 10:50374077-50374099 TTTTCTCTTTGGCACAAAGCAGG + Intronic
1070132720 10:73666119-73666141 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1071102363 10:82053960-82053982 TGATATCTTTAGGGAACAGCTGG + Intronic
1071608964 10:87017955-87017977 TGCCCTCTGTGGGGCACAGATGG + Intergenic
1073460680 10:103664076-103664098 TGTTCCCCTAGGGGCACAGTGGG - Intronic
1074286275 10:112100879-112100901 TGTCCTCTTTTAGTCACAGCTGG + Intergenic
1075013270 10:118892684-118892706 TGTTCTCATTGGGGCAGAAAAGG + Intergenic
1077226466 11:1440996-1441018 TGTAGTCCTTGGGGCACAGGGGG - Intronic
1077233794 11:1470294-1470316 CGGTCTCTTTGGGGTCCAGCAGG + Exonic
1079003120 11:16774144-16774166 GGCTCTCTTTGGGGCACTGAGGG - Intergenic
1079252616 11:18798065-18798087 CGTTCTCTTCTAGGCACAGCAGG + Intergenic
1083384770 11:62299434-62299456 TGTTCTCTTTATGGGAGAGCAGG + Intergenic
1086094222 11:83034387-83034409 CCTGCTCTTTGGGGCAAAGCTGG - Intronic
1086435275 11:86773852-86773874 TCTGCACTTTGGGGCACAGCTGG - Intergenic
1089401901 11:118169141-118169163 TGTGGTCTTTGGGGCAAAGCGGG + Intronic
1090387390 11:126364930-126364952 TGTTCTCTTTGGGGCACAGCTGG + Intronic
1090389956 11:126382128-126382150 TGTTCTCTTTGGGGCACAGCTGG + Intronic
1090843260 11:130510779-130510801 TGTTCTCCTTGGGCCACGCCTGG + Intergenic
1090869563 11:130731223-130731245 TGTTCTGATTGGGGCCCCGCTGG + Intergenic
1092083210 12:5735204-5735226 TGTTGTGTTTGGGGAACATCAGG - Intronic
1093243130 12:16702084-16702106 TATTCTCTTTCTGGGACAGCAGG + Intergenic
1095987178 12:48006175-48006197 TGTCCTCTTTGGGGCTCAGAAGG + Intergenic
1097803676 12:63942514-63942536 TGTTCTCTTTCAGTCCCAGCTGG + Intronic
1097881920 12:64694213-64694235 TGTTCTGTTTGGGGAACAGATGG + Intronic
1099390176 12:82070030-82070052 TGATCCCTTTGAGCCACAGCTGG + Intergenic
1099749768 12:86757892-86757914 TGTCCTCTCTGGGTCACATCTGG + Intronic
1103960368 12:124605675-124605697 TGTTATCTGGGGGGCTCAGCTGG - Intergenic
1104777282 12:131397879-131397901 TGGCCTCTTTTAGGCACAGCTGG + Intergenic
1108402349 13:50058918-50058940 TGTTTTCTTTGGAGAAAAGCAGG - Intergenic
1110451099 13:75637370-75637392 TCTTGTCTGTGAGGCACAGCTGG - Intronic
1110685642 13:78370400-78370422 TGGTCTCTTTGTGGGACACCAGG - Intergenic
1112348758 13:98615119-98615141 CATTCTCTTTGTGGCTCAGCAGG - Intergenic
1112414233 13:99190991-99191013 TGTTGTCTCAGGGACACAGCTGG + Intergenic
1114621448 14:24098686-24098708 TGTTCCCCTTGGGGCAGAGCAGG - Intronic
1115136824 14:30119925-30119947 TCTTGTGTTTGGGGAACAGCTGG - Intronic
1119049062 14:71348270-71348292 TGTTATCTTTGGGGTGCAGGAGG - Intronic
1120394248 14:83947742-83947764 TGTTCCCTTTGTGGTACAGAAGG + Intergenic
1121660257 14:95629881-95629903 TGTTGCCTTTGAGGCACTGCTGG + Intergenic
1121741426 14:96254904-96254926 CGTGCTCTTTGTGGCAGAGCTGG + Intronic
1122267026 14:100551307-100551329 GGTTCTCTCTGGGGATCAGCTGG + Intronic
1123752848 15:23372207-23372229 TGTTCTCTTAGTGGAACTGCAGG - Intergenic
1125511829 15:40296382-40296404 TCTTCTCCTTAGGGCACAGCGGG - Exonic
1127601193 15:60538497-60538519 TATTCTCTTTGTGGCATAGCTGG - Intronic
1128838841 15:70832987-70833009 GGTTCTCGTTGGGGAACAGTGGG + Exonic
1128881088 15:71243527-71243549 TCTTCTCTTAGGGGAAGAGCTGG + Intronic
1129359726 15:75017202-75017224 TGTTCCCTTTGGCACACAGTTGG - Intronic
1129535392 15:76310312-76310334 TTTTCTCTCTGAGGCATAGCTGG - Intronic
1130745571 15:86650098-86650120 AGTTCTTTTTGTGGCACAGGGGG + Intronic
1131313945 15:91316107-91316129 TGATCTCTTTGGGGCCCAGATGG + Intergenic
1131428219 15:92364685-92364707 TGTTCAGTTTGGGGCAGAGCAGG - Intergenic
1131644249 15:94325060-94325082 TGATGTCTGTAGGGCACAGCAGG - Intronic
1131890375 15:96965819-96965841 TGCTCACTTTGAGGCACAGAGGG + Intergenic
1132405166 15:101537416-101537438 TGCTGTGTTTGGGGCACAGGTGG - Intergenic
1132832727 16:1937075-1937097 TGTGCCCTTTGGGGCACTCCTGG + Intergenic
1141950513 16:87336322-87336344 TGTCCTCTCAGCGGCACAGCCGG - Intronic
1143334567 17:6162621-6162643 AGTTCTGTTTGGTGCAGAGCCGG - Intergenic
1143681724 17:8480793-8480815 TGTTGTCTGTGGAGAACAGCTGG - Intronic
1145926967 17:28655168-28655190 TGTTCTCTTTTGTGCAGACCTGG - Intronic
1146258853 17:31408774-31408796 TGTTCTCCTTGACTCACAGCTGG - Intronic
1148086322 17:44995796-44995818 TGTGCTCTGTGGGGCCCACCCGG + Intergenic
1148559818 17:48599488-48599510 CGTTCTCTTGGGGACTCAGCAGG + Intronic
1148801007 17:50225814-50225836 TGGTCCCTTTTAGGCACAGCTGG + Intergenic
1149186045 17:53999399-53999421 TGTTCTCCTTGAGGAACACCTGG - Intergenic
1149671990 17:58422611-58422633 TGGTCTCTTTGGGTTACAACTGG - Intronic
1151447625 17:74177493-74177515 AGCTCTCTCTGGTGCACAGCAGG - Intergenic
1151840064 17:76611260-76611282 TGTTCTCTGGCGGGCAGAGCGGG + Intergenic
1157570570 18:48709601-48709623 TTGTCTCCTTGGGGCACACCCGG + Intronic
1158157024 18:54437450-54437472 TGTTTTGTTTGGAGCAGAGCAGG - Intergenic
1158972194 18:62679086-62679108 TCTTCTCTTTGGGGAACAAAGGG - Intergenic
1159017783 18:63115743-63115765 TGTCCTATTTGAGCCACAGCTGG - Intergenic
1159879599 18:73845943-73845965 AGCTCTCTATGGGGCACAGAGGG - Intergenic
1160394532 18:78562235-78562257 TGTTTTCTTGGGGGCTCAGTGGG + Intergenic
1160689985 19:457113-457135 AGTTCTAGTCGGGGCACAGCAGG - Intronic
1160689996 19:457176-457198 AGTTCTAGTCGGGGCACAGCAGG - Intronic
1160690007 19:457239-457261 AGTTCTAGTCGGGGCACAGCAGG - Intronic
1160952709 19:1675380-1675402 TTTTCCCTTTGGGGAACAGGTGG + Intergenic
1162595640 19:11626801-11626823 GGTTCTGTTTGGTTCACAGCAGG + Intergenic
1163235112 19:16025354-16025376 TGTTCTCTTGGGGCCCCAGCGGG + Intergenic
1165093681 19:33399408-33399430 TCTTCCTTTTGGGGCACATCTGG + Intronic
1165210714 19:34233527-34233549 TGTTCTCTTTTGGGGTTAGCTGG + Intergenic
1165333771 19:35155326-35155348 TGTTTTCTTTGGGGACCTGCAGG + Exonic
1167917853 19:52756666-52756688 TGTTCTCTTGAGGGCAGGGCCGG - Intergenic
1168460234 19:56549100-56549122 TGCTCTGTTTGAGACACAGCCGG + Exonic
925329112 2:3044657-3044679 TGGTCTCTGTGCGGCACTGCTGG + Intergenic
925634238 2:5927201-5927223 TGTTCCCTTTGGGAGACAGGGGG - Intergenic
925702252 2:6650519-6650541 TGTTCTCATGTGGACACAGCTGG + Intergenic
925977292 2:9150197-9150219 TGCGCTCTGTGGGGCAGAGCAGG + Intergenic
926775337 2:16416723-16416745 TCTTCTTTTTGGACCACAGCTGG + Intergenic
927053437 2:19350666-19350688 TCTTCTCCTTGGGGCAAGGCGGG - Intergenic
929510536 2:42562815-42562837 TCTTCTCTTTGGGAAACAGTTGG - Intronic
929646664 2:43635650-43635672 TATTCTCTTTGGTTCACAGTTGG - Intergenic
934888447 2:98045370-98045392 TGTTCTCTTGAGGGCAGGGCGGG + Intergenic
934901719 2:98165141-98165163 GGTTTCCTTTGGGGCACACCTGG + Intronic
935169716 2:100601640-100601662 TGTCCTCTTTTGGAGACAGCAGG + Intergenic
936569825 2:113603676-113603698 CGTTCTCTTTAGCACACAGCCGG - Intergenic
938943537 2:136190272-136190294 TGTACTCCTTGGGGGACAGAGGG - Intergenic
939100477 2:137889873-137889895 TTCTCTCTTTGAAGCACAGCAGG - Intergenic
942315469 2:174693124-174693146 TGCCCTCTTTGGGGCTCAGCAGG + Intergenic
944101977 2:196036785-196036807 TCTGCTCTTTGGGGCCCAGATGG - Intronic
945291103 2:208128274-208128296 TGTACTCTTGGGGCCTCAGCAGG + Exonic
946228780 2:218279086-218279108 GGTTCCCTGTGGGGCACAGGAGG + Exonic
947531508 2:230911688-230911710 TTTTCTCTTTGGGGTACAAGAGG - Intronic
948195509 2:236092864-236092886 TGCTTTCTTTCTGGCACAGCAGG - Intronic
948371799 2:237494312-237494334 TGCTCTCCCTGGGGCACACCAGG - Intronic
1169081745 20:2801412-2801434 TTTACTCTTTGGGGAACTGCCGG + Intergenic
1169464431 20:5824979-5825001 TCTTCTCTTTGGGGTATAACAGG - Intronic
1170071309 20:12372120-12372142 TGTTCTCTGAGGAGCACAGCTGG + Intergenic
1170071368 20:12372724-12372746 TGTTCTCTGTGGAGAACAGCTGG - Intergenic
1171411248 20:24950160-24950182 AGTTCCCTTTGGGGGAGAGCAGG - Intronic
1173192381 20:40886449-40886471 TGGTCTCTCTGGTGCACAGAGGG - Intergenic
1174572418 20:51511528-51511550 AGTTCTCTTTGGGGCATAGAAGG - Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1182277246 22:29197972-29197994 TGCCCTCTTTGGAGCACAGTTGG - Intergenic
1182469605 22:30540047-30540069 TATTCTCTTTGGGCCCCAGATGG + Intronic
1182934769 22:34210620-34210642 TGTTCTCCATTGGGCAAAGCTGG + Intergenic
1183191018 22:36322150-36322172 TGAGCACTCTGGGGCACAGCAGG + Intronic
1184312752 22:43658657-43658679 CGTGCCCTTCGGGGCACAGCTGG + Intronic
1184335094 22:43848273-43848295 GATTCTCTTTGGGCCTCAGCAGG - Intronic
1185082468 22:48717656-48717678 CGTTCTCTGTCGGGCACTGCAGG + Intronic
950143151 3:10629047-10629069 TTTTCTCCGTAGGGCACAGCCGG + Intronic
952209825 3:31218953-31218975 TGTGCTCTTTGGGGCCTTGCAGG + Intergenic
952622523 3:35362633-35362655 TGAAGTCTTTGGGACACAGCAGG - Intergenic
953788505 3:45929121-45929143 TGGTCTCTTTGGGGGACCTCAGG + Intronic
954570826 3:51639522-51639544 TGTTCCCTGTGGTGGACAGCGGG - Exonic
954972796 3:54665096-54665118 TCTTCCCCTTGGGGCACTGCTGG - Intronic
955481380 3:59393909-59393931 ATTTTTCTTTGGGGCACTGCTGG + Intergenic
960564427 3:119118421-119118443 TGGTCCCTTTCGGCCACAGCTGG + Intronic
961005795 3:123404556-123404578 TCTTCTCTCTGGAACACAGCTGG - Intronic
962341434 3:134587720-134587742 TGCTCTCTTTGGAGCTCACCTGG + Intergenic
962811568 3:138963100-138963122 TGTTGTCTTTGGGGCTAATCTGG - Intergenic
967074233 3:185987836-185987858 TGTCTTCTTTGGTACACAGCTGG + Intergenic
968894205 4:3389281-3389303 TGGTCTCTGGGGGGCACGGCAGG + Intronic
969525661 4:7702709-7702731 TGAGCTCTGTGGGGCACAGAAGG + Intronic
969593219 4:8133537-8133559 TGTCCTCTTTGGGGCGCACTAGG + Intronic
970312694 4:14798960-14798982 TGCTCTCTTTTAGTCACAGCTGG + Intergenic
973107755 4:46361327-46361349 TGTCCTCTTTTAGTCACAGCTGG - Intronic
976379033 4:84378721-84378743 TCTTCCCTTTGGGGGGCAGCAGG + Intergenic
979740444 4:124143376-124143398 TGTCCTCTTTTAGCCACAGCTGG - Intergenic
982547849 4:156758188-156758210 TGTTTTCTTTGGAGCACTGTTGG - Intergenic
985666816 5:1185663-1185685 TCTGCTCTATGGTGCACAGCTGG - Intergenic
986923126 5:12712491-12712513 TTTTCACTTTAGGCCACAGCAGG - Intergenic
987130446 5:14855159-14855181 TATTCTCTTTAGGCCTCAGCTGG + Intronic
989672631 5:43936410-43936432 GTTTCTCTCTGGGTCACAGCAGG - Intergenic
990857256 5:60282615-60282637 TGTTGGGTTTGGGGCCCAGCTGG + Intronic
992961326 5:81959037-81959059 TGTTCTCTGGTGGGCAGAGCGGG - Intergenic
993441518 5:87962436-87962458 TTTTCTACATGGGGCACAGCTGG + Intergenic
993630890 5:90284756-90284778 TGTTCTCATTGGAGCAATGCTGG + Intergenic
994489434 5:100423057-100423079 TGTTTTGTTTGAGCCACAGCTGG - Intergenic
994799464 5:104353314-104353336 TGTTATATTTGGGCCACAGGTGG - Intergenic
996759843 5:126976202-126976224 TGTCCTCTATGGGACACACCTGG + Intronic
996976278 5:129438866-129438888 TATTGTCTTTGTGGCACAGAAGG - Intergenic
997373155 5:133375185-133375207 TGTTTTCTTTGGAAAACAGCAGG - Intronic
997426745 5:133808366-133808388 TGTTCAATCTGGGGCACATCTGG + Intergenic
999719803 5:154391193-154391215 TGTTCTCTTTCAGCCAGAGCTGG + Intronic
1002923097 6:1587086-1587108 TTTTCCCTTGGGGGCACTGCAGG - Intergenic
1004106715 6:12672816-12672838 TGTTCTCTGTCGGGCAGAGTGGG - Intergenic
1004917194 6:20342884-20342906 AGTTCTGTTTGTGGCACAGAAGG + Intergenic
1005295681 6:24424441-24424463 TTTTCTTTTTGGGGCAGGGCAGG - Exonic
1006332855 6:33404835-33404857 TGTTCTCTTCTGGGCAGAGGAGG + Exonic
1007093496 6:39199373-39199395 TGTGCCCTTTGGGGACCAGCTGG + Intronic
1008142763 6:47851092-47851114 TGTTCTCCTTGGAGCATAACTGG - Intergenic
1011140123 6:84144966-84144988 TGTTCTCTTTGTAACACAACTGG + Intronic
1011922016 6:92589824-92589846 TATTCTATTTGGGGTAGAGCTGG + Intergenic
1011955958 6:93025699-93025721 TGGTCTCTTTTAGCCACAGCTGG + Intergenic
1016851249 6:148621477-148621499 TGTCCTCTCTGGAGCATAGCTGG + Intergenic
1017757172 6:157539451-157539473 TCTTCTCTCCGGGGGACAGCTGG - Intronic
1018072008 6:160173283-160173305 TATTCCCATTGGGGCAAAGCAGG - Intronic
1019290572 7:248197-248219 TGTGCTCTGTGCGGCTCAGCGGG - Intronic
1019290588 7:248265-248287 TGTGCTCTGTGCGGCTCAGCGGG - Intronic
1023253089 7:38286004-38286026 CCTTCTCCTTGGGACACAGCAGG - Intergenic
1024025531 7:45406953-45406975 TCTTGTCTATGGGGCACATCTGG + Intergenic
1025069060 7:55883246-55883268 TGTTCTGTTTGGGGGATAGAGGG - Intergenic
1028311815 7:89347897-89347919 TGTTGTCTTTTTGGCACGGCCGG - Intergenic
1031583906 7:123510170-123510192 TGTTATCATTGGGGCACAGCAGG - Intronic
1031631132 7:124044384-124044406 TGTTCTGGTTGTGGCATAGCTGG - Intergenic
1032497633 7:132374700-132374722 TGTTTTCTTGGGGGCAAAGCTGG - Intronic
1033233757 7:139622092-139622114 TGCTATCTTTGGGGCTAAGCAGG + Intronic
1034335655 7:150322011-150322033 TGTTCACTTTGGTGCACATGTGG + Intronic
1035027233 7:155833999-155834021 TGTCCTCTTTGGGGCCGAGTGGG + Intergenic
1036227124 8:6969062-6969084 CGTTCTCTTTGTGGCCCTGCAGG - Intergenic
1038550888 8:28467676-28467698 CATTCTCTTTTGGGGACAGCGGG - Intronic
1039973594 8:42340889-42340911 TATTCTATTTGGATCACAGCAGG + Intronic
1040615852 8:49037657-49037679 TTTTCTCCTTGGAGCACAGCTGG + Intergenic
1041324703 8:56652103-56652125 AGTGCTCTTTGGGGAGCAGCAGG + Intergenic
1042216671 8:66435021-66435043 TGTTATCTCTGGGGTACAGCAGG + Intronic
1044345807 8:91103055-91103077 TGTGCTCTTTGGCCCACATCTGG + Intronic
1044587160 8:93878530-93878552 TGTTCTCTTGGGGGCAGGGACGG + Intronic
1048100881 8:131350317-131350339 TGCTATATTTGGGCCACAGCAGG + Intergenic
1049117759 8:140704502-140704524 AGTTCTCTTTGTGTCCCAGCAGG - Intronic
1051015830 9:12474852-12474874 TGGTCCCTTTCGGCCACAGCTGG - Intergenic
1052019344 9:23508148-23508170 TGCTCCCTTTTGGCCACAGCTGG - Intergenic
1052557791 9:30040519-30040541 TTTTCTTTTTTTGGCACAGCTGG + Intergenic
1052611152 9:30774752-30774774 GGTTCTCTTTGGGGAGCAGGAGG + Intergenic
1053006286 9:34606957-34606979 TGGTCTCTACGGGGCCCAGCTGG - Intergenic
1053398520 9:37798023-37798045 TGTTTTCTTTGGGCTACAGAAGG + Intronic
1056273813 9:84973328-84973350 TGTTCTCTCTGTGGCAAAGTTGG - Intronic
1056580775 9:87887009-87887031 GGTTCTGTGTGAGGCACAGCTGG + Exonic
1059889532 9:118785770-118785792 TTCTCTCTTTGGGGAACAGAGGG + Intergenic
1060701466 9:125753757-125753779 TGTGCTCTTTGGGGCAAGTCGGG - Intronic
1060819444 9:126652821-126652843 AGTTCACTTGTGGGCACAGCAGG + Intronic
1061026390 9:128052476-128052498 TGTTGTCTTTGTAGGACAGCTGG + Intergenic
1062028277 9:134350524-134350546 TGTCTTCCTTCGGGCACAGCAGG + Intronic
1186046707 X:5544402-5544424 GCCACTCTTTGGGGCACAGCTGG + Intergenic
1186866044 X:13721897-13721919 TGTTGGCTTTGTGGGACAGCTGG - Intronic
1187473996 X:19593560-19593582 GGGTCTCTGTGGGGCAAAGCAGG - Intronic
1190738338 X:53270377-53270399 TGGTCTGTTTGGGGAGCAGCAGG - Intronic
1191004790 X:55699852-55699874 TGTTCACTGTGAGGCAGAGCTGG + Intergenic
1193833722 X:86317414-86317436 TGTTTTCCTTGAGACACAGCTGG + Intronic
1194960337 X:100227901-100227923 AGTTCTCTTTGGAGAACATCTGG - Intergenic
1197688492 X:129471277-129471299 TCTTCTCTTTGAGCCAGAGCTGG + Exonic
1198524055 X:137482278-137482300 GTTGCACTTTGGGGCACAGCTGG - Intergenic
1198524322 X:137485167-137485189 GCTGCACTTTGGGGCACAGCTGG + Intergenic
1199003017 X:142662856-142662878 TGGTCTCTTTTAGCCACAGCTGG - Intergenic
1199662003 X:150060745-150060767 TGTTCTCTCTAGGGCACAGCAGG + Intergenic
1200718338 Y:6575594-6575616 TGGCCCCTTTGAGGCACAGCTGG - Intergenic