ID: 1090394308

View in Genome Browser
Species Human (GRCh38)
Location 11:126408637-126408659
Sequence CGCCTTAGGCTGCCCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090394303_1090394308 -4 Left 1090394303 11:126408618-126408640 CCGGGCTCCCGGAAGTCAGCGCC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1090394308 11:126408637-126408659 CGCCTTAGGCTGCCCTCCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 76
1090394299_1090394308 26 Left 1090394299 11:126408588-126408610 CCTAAAGAGGCTGTGAGGGGACA 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1090394308 11:126408637-126408659 CGCCTTAGGCTGCCCTCCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090394308 Original CRISPR CGCCTTAGGCTGCCCTCCAA GGG Intronic
902973954 1:20075258-20075280 CTCCTTAGCCTGACCCCCAAGGG + Intronic
914325047 1:146604866-146604888 GTCCTTAGGCTGGCATCCAAGGG - Intergenic
921255980 1:213339930-213339952 CGCCTTAGGCTGGAGTGCAATGG + Intergenic
921724952 1:218513494-218513516 TGCCTTTGGCTGCCAACCAAAGG - Intergenic
1069601718 10:69712278-69712300 CGCCCTCCGCTGCCCTCCCAGGG - Intergenic
1075497536 10:122938127-122938149 CGACTGAAGCTGCTCTCCAATGG + Exonic
1075593131 10:123707163-123707185 CGCCTCATGCTGCCCTGGAAGGG - Intronic
1076874559 10:133209719-133209741 AGCCCCAGGCTGCCCTGCAAAGG - Intronic
1082838175 11:57667122-57667144 CTCCTTAGGCTTCCCTCTCACGG + Intergenic
1083701181 11:64478585-64478607 GGCTTTAGGCTGCCCTCTGAGGG + Intergenic
1083880432 11:65545804-65545826 GGACTTAGGGGGCCCTCCAAGGG + Intronic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1084182242 11:67452582-67452604 CTCCTTGGGCTGCCAGCCAATGG - Exonic
1089111970 11:116064344-116064366 GGCCATGGGCTCCCCTCCAAGGG - Intergenic
1089340053 11:117751039-117751061 TGCCTCTGGCTGCCCCCCAATGG - Intronic
1090394308 11:126408637-126408659 CGCCTTAGGCTGCCCTCCAAGGG + Intronic
1094832574 12:34307115-34307137 TGCTTTAGGGTGCCCCCCAAGGG - Intergenic
1094846789 12:34364847-34364869 CGCCTTGGGCTGGCCGCCATGGG + Intergenic
1094848770 12:34373071-34373093 CGCCTTAGGCTGGCCCCCGTGGG + Intergenic
1094850924 12:34382052-34382074 CGCCTTTGGCTGGCCCCCATAGG + Intergenic
1094851578 12:34384640-34384662 CGCCTTGGGCTGGCCTCCTTGGG + Intergenic
1094851737 12:34385371-34385393 CGCCTTGGGCTGGCCCCCATAGG + Intergenic
1094852531 12:34388707-34388729 CGCCTTGGGCTGGCCCCCATGGG + Intergenic
1094854013 12:34394893-34394915 CGCATTAGGCTGGCCTCCGTGGG - Intergenic
1094854368 12:34396384-34396406 CACCTTGGGCTGGCCTCCATGGG - Intergenic
1094855542 12:34401236-34401258 CGCCATGGGCTGGCCCCCAAGGG - Intergenic
1094871081 12:34599625-34599647 CGCCTTGGGCTGCCCCCCTTTGG - Intergenic
1094871254 12:34600380-34600402 CGCTTTAGGCTGCCCCCCGTGGG - Intergenic
1094872045 12:34604131-34604153 CGCTTTTGGCTGCACTCCATTGG - Intergenic
1094872231 12:34604883-34604905 CGCTTTAGGCTGCCCCCCGTGGG - Intergenic
1114604825 14:23988329-23988351 GACCGTAGTCTGCCCTCCAAGGG + Intronic
1115027211 14:28759289-28759311 CCCCACAGGCTGCTCTCCAAAGG + Intergenic
1127708794 15:61574664-61574686 CTCCTTAGCCTAGCCTCCAAGGG - Intergenic
1131972850 15:97909485-97909507 CGTGTTAGGCTGCCCTCTCATGG - Intergenic
1140008517 16:71106080-71106102 GTCCTTAGGCTGGCATCCAAGGG + Intronic
1141232151 16:82178485-82178507 CAATTTAGGCTGCCATCCAATGG - Intergenic
1142108679 16:88319574-88319596 CTCCCCAGGCTGCCCTCCTAGGG + Intergenic
1142689017 17:1593616-1593638 AGCCTCAGGCAGCCCTCAAAGGG + Intronic
1143350223 17:6282680-6282702 ATCCTGAGGCTGCCCTCCAGAGG - Intergenic
1150122075 17:62612324-62612346 AGCCTTAGGGTTCCCTCCAGGGG + Intronic
1151231500 17:72688469-72688491 TGCCTTCAGCTGCCCTCCACTGG + Intronic
1158495209 18:57949140-57949162 CACCTTTGGCTGCCCATCAACGG + Intergenic
1158551290 18:58438284-58438306 CTCCTTAGCCTGGCCACCAAGGG + Intergenic
1163376065 19:16931272-16931294 TGCCTGAGGGTGCCATCCAAGGG + Intronic
1166279294 19:41780159-41780181 TTCCTTAGGCTGCCATTCAAAGG - Intergenic
927153137 2:20207013-20207035 CACCTGAGGCTGGGCTCCAAAGG + Intronic
930033107 2:47070117-47070139 TGCCTGATGATGCCCTCCAAGGG - Intronic
933820956 2:86111782-86111804 TGCCTTAGGCTGCAGTGCAATGG + Intronic
937693438 2:124781477-124781499 AGTCTCAGGCTGCCTTCCAAGGG - Intronic
1175658703 20:60793785-60793807 TGCCTTAGGTTGCCTTCCCAGGG - Intergenic
1175905618 20:62378027-62378049 ATCCTAAGGCTGCCCTGCAAAGG - Intergenic
1180839907 22:18954464-18954486 CGCCTTCAGATGCCCTCAAATGG + Intergenic
1182574976 22:31266873-31266895 CGGCTCAGTGTGCCCTCCAAGGG + Intronic
954257892 3:49418979-49419001 CAACTGAGGCTGCCCTCCACAGG + Exonic
956868379 3:73391785-73391807 AGCCTTAGGGTGCCATCCTAGGG + Intronic
957541821 3:81580797-81580819 CGTCTTAGGCTGCCTTCTAGAGG - Intronic
959562483 3:107798621-107798643 CTCTTTTGGCTGCCCACCAAAGG - Exonic
961125069 3:124409945-124409967 CTCCTAAGGCTGCCCTCCCTGGG - Intronic
969689391 4:8695971-8695993 CTCCTGACACTGCCCTCCAATGG + Intergenic
970635965 4:18009786-18009808 TGCCTTAGCATGCCTTCCAATGG + Intronic
976272788 4:83247846-83247868 CAACTGAGGCTGCCCTCCACAGG - Intergenic
985926763 5:3025257-3025279 CGCCTCAGACTGCCATCCAAAGG + Intergenic
989368730 5:40682513-40682535 TGCTTTAAGCTGCCCTCCCAGGG - Intronic
997589911 5:135066240-135066262 CACCTCAGGCTGCCCAGCAAGGG - Intronic
999770218 5:154770006-154770028 CTCCCTAAGCTGGCCTCCAAAGG - Intronic
1006028339 6:31161656-31161678 CGGCCTATGCTGCCCTCCCAGGG + Exonic
1006166698 6:32069657-32069679 TCCCTGAGGCTGCCCTCCACGGG + Intronic
1013048553 6:106510821-106510843 CGCCTTAGCCGGAGCTCCAATGG - Intergenic
1018656840 6:166045041-166045063 CACCTTGGGCTTCCCTCCAGTGG + Intergenic
1022946637 7:35291906-35291928 CACCTTAGCCCTCCCTCCAAGGG + Intergenic
1059332890 9:113547428-113547450 CGTCTTGTGCTGGCCTCCAATGG - Intronic
1059868562 9:118545359-118545381 CATCTTAGGCTGCACTGCAAAGG - Intergenic
1061264153 9:129496033-129496055 CGCATTGGGCTGTCCTTCAAGGG + Intergenic
1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG + Intronic
1200706742 Y:6449482-6449504 CGCATTGGACTGGCCTCCAATGG + Intergenic
1201027370 Y:9715226-9715248 CGCATTGGACTGGCCTCCAATGG - Intergenic
1202180798 Y:22138254-22138276 CACCTCAGACTGGCCTCCAACGG + Intergenic
1202210562 Y:22448146-22448168 CACCTCAGACTGGCCTCCAACGG - Intergenic